Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067458 Similarity: 0.978 Similarity: 0.972 Similarity: 0.969
UTR: 5HSAA067458
Gene: MRPL36_0
MFE: -38.313
ENS: 0.976
Length: 119.
Predicted Ligands:
SAM - 8/20
methionine - 6/20
cobalamin - 2/20
 RS: URS0000D845C0_1109743
MFE: -57.176
Ligand: methionine
Species: Streptomyces sp. SCSIO 03032 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D996EA_1857892
MFE: -55.376
Ligand: methionine
Species: Streptomyces sp. MP131-18 S-adenosyl methionine (SAM) riboswitch,
 RS: URS000232E59B_1073574
MFE: -45.781
Ligand: cobalamin
Species: Gordonia araii NBRC 100433 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067458 URS0000D845C0_1109743 URS0000D996EA_1857892 URS000232E59B_1073574
Length 119. 120. 119. 119.
Similarity - 0.978 0.972 0.969
Ensemble Norm 0.976 - - -
MFE -38.313 -57.176 -55.376 -45.781
Ligands - methionine methionine cobalamin
Gene MRPL36 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 11.003 4.
Length SE - 1. 0. 0.
Lev Distance - 28. 33. 40.
UBS 8. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 2.
ILR 2. 2. 3. 2.
H 3. 3. 3. 4.
BL 3. 4. 1. 2.
BR 3. 3. 2. 2.
UN 0.143 0.092 0.092 0.160

Sequences

Field Description
UTR seq + 25 cagcguccgcgugccagugcgcagacgcaggggucggcgccgggugagagcgugcggccggguaagggagccgucuucucagauucaccacaacATGGCAAATCTTTTTATAAGGAAAA
UTR dot + 25 ..(((((.((((……)))).)))))(((((.(((((((.(((………..))).)))……)))).))))).(((((..(((…..)))..)))))…………..
RS 1 seq GGUCACGAGUGACAGCACGCAUGGACCCCGGUCCGCUGUCCGGCAACCCUCCUUCCGUGGCGGGGUGCUCCCGGGUGAUGACCGGGCCGCGGGCAGCAAGGUCCGCGGCAAGCGCGGAUU
RS 1 dot ((((.((.(((……))).))))))((((((((((….((((.(((.((……)).))).))))….))))..))))))(((((((((……)))))))))………..
RS 2 seq GGUCACGAGUGACAGCGCUGAUGGACCCCGGUCCGCUGUCCGGCAACCCUCCUGCCGUGGUGGGGUGCUCCGGGUGAUGACCGGGCCGCGGACAGCAAGGUCCGUGGCAAGCGCGGAUC
RS 2 dot ((((.((((((….))))..))))))((((((..(..(((((..(((((((……)).)))))…))))).)..))))))(((((((((……)))))))))………..
RS 3 seq GACUACAGUAAAGCGGUCAGCAGAUGCGGGGAACCCGGUGCGAAGCCGGGACGGCCGCGCCACUGUGAGUCGCCGGGAGGCGGCGAGUCAGGACACCGCGCUGACAGACGUAGGAAUGC
RS 3 dot ((((.(……).)))).((((..(((.((..((((((…..))))))….)).)))..))))..((((((….))))))..(((((………)))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table