Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067525 Similarity: 0.967 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA067525
Gene: MRPL45
MFE: -19.645
ENS: 0.832
Length: 129.
Predicted Ligands:
SAM - 7/20
FMN - 6/20
cobalamin - 6/20
 RS: URS0000DB5DED_1121429
MFE: -40.792
Ligand: FMN
Species: Desulfotomaculum putei DSM 12395 FMN riboswitch (RFN element)
 RS: URS0000C10783_284581
MFE: -35.
Ligand: SAM
Species: Bacillus koreensis SAM riboswitch (S box leader)
 RS: URS0000C5F13F_1629715
MFE: -33.967
Ligand: FMN
Species: Peptococcaceae bacterium BRH_c8a FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067525 URS0000DB5DED_1121429 URS0000C10783_284581 URS0000C5F13F_1629715
Length 129. 128. 127. 130.
Similarity - 0.967 0.967 0.966
Ensemble Norm 0.832 - - -
MFE -19.645 -40.792 -35. -33.967
Ligands - FMN SAM FMN
Gene MRPL45 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 15.001 9.001
Length SE - 1. 4. 1.
Lev Distance - 42. 34. 41.
UBS 8. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 6. 5. 3. 4.
H 1. 1. 1. 1.
BL 4. 5. 4. 4.
BR 0. 1. 2. 2.
UN 0.023 0.047 0. 0.062

Sequences

Field Description
UTR seq + 25 agaauccggaggauaaaagacuaugaugccaacuuuaaaauaaaggacuucccugaaaaagcuaaggauaucuuuauugaagcucaccuuugucuaaauaagacATGGCAGCCCCCATACCTCAAGGGT
UTR dot + 25 …((((.((((………((((.(((((.(((….(((((((.(((((((……….)))………..))))….)))))))……)))…)))))…..))))))))..))))
RS 1 seq UAAGACCUUCAGGGAUAGGUGUAAUUCCUUACCGGCGGUAUGGCCUUGGCCGAGCCCGCGAGCCCCUCGGGGCAGAUCCGGUGAGAAGCCGGAGCCGACAGUGAAAGUCUGGAUGGGAGAAGGUUCAU
RS 1 dot …(((((((……………((((..((((((((.((((.((.((((.((((.((((…))))))))…..)))).))..))))..))))………..))))..)))))))))))…
RS 2 seq CUCUUAUCCCGAGCUGGUGGAGGGACAGGCCCUAUGAAACCCAGCAACCAUCACCAUACUUUAUAUUUUUUUACUUGGUGAUAAGGUGCUAACCUGAUGCAAGGGGAAAGCCCUUGAUCGAUAAGAG
RS 2 dot ((((((((…….(((.(((((.(…((((.((……(((.((((((((((……………….)))))))..))))))………)).))))…)))))).)))))))))))
RS 3 seq UAAAACCUUCAGGGACAGGUGAAAUUCCGUACCGGCGGUAAGAGGUUAAGCUUCAAGCCCGCGAGCCCGCAAGGGUUGAUCCGGUGUAACUCCGGAGCCGACAGUAAAGUCUGGAUGGGAGAAGGUAAUU
RS 3 dot ….((((((…………..((((((.((((((((….(((((.(((((((.((.(((….)))..)).))))…))).)))))…..))))……….))))))))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table