Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067533 Similarity: 0.975 Similarity: 0.974 Similarity: 0.971
UTR: 5HSAA067533
Gene: MRPL48
MFE: -46.142
ENS: 0.882
Length: 125.
Predicted Ligands:
molybdenum - 7/20
glycine - 6/20
cobalamin - 4/20
 RS: URS0000AB3B19_743525
MFE: -64.779
Ligand: molybdenum
Species: Thermus scotoductus SA-01 Moco (molybdenum cofactor) riboswitch
 RS: URS000231E223_1618961
MFE: -28.663
Ligand: cobalamin
Species: Parcubacteria group bacterium GW2011_GWF2_38_8 Cobalamin riboswitch
 RS: URS0000DA9C89_1817879
MFE: -36.322
Ligand: molybdenum
Species: Candidatus Schekmanbacteria bacterium RBG_16_38_10 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067533 URS0000AB3B19_743525 URS000231E223_1618961 URS0000DA9C89_1817879
Length 125. 124. 125. 127.
Similarity - 0.975 0.974 0.971
Ensemble Norm 0.882 - - -
MFE -46.142 -64.779 -28.663 -36.322
Ligands - molybdenum cobalamin molybdenum
Gene MRPL48 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 7.001 6.001
Length SE - 1. 0. 4.
Lev Distance - 30. 33. 32.
UBS 5. 6. 5. 5.
BS 3. 3. 3. 3.
ILL 1. 0. 0. 2.
ILR 0. 1. 0. 0.
H 2. 3. 3. 2.
BL 4. 3. 3. 2.
BR 4. 2. 2. 3.
UN 0.144 0.169 0.176 0.173

Sequences

Field Description
UTR seq + 25 uggucaaggccguuccuucaguguuuucagacgcccugggaacgcggcugcaggguccggucuucgguuugcacagcuagaggccgcgcagcagcaaaggATGAGCGGAACCTTGGAAAAGGTGC
UTR dot + 25 …((((((((((((.(((.((((((((((…..)))))))))).(((((…((.(((((((.((((…..)))).))))))).)).)))))…))).))))))..))))))………
RS 1 seq CAUCCCCUUAGCCUCCGAGCCCGGAUAGACCCCAUGGGCCUUCCGGGCCGGGCUUAUGGCCCCGGGGUGGUGGGGGCAACCCCGCCGCCUGCCGCGGUUGCAAAGGAGGUAAGGGUGAACAAAA
RS 1 dot ..(((((((.((((((..(((((((.((.(((…))).))))))))).(((((…)))))(((((((((((((….))))))))))..)))……….))))))))))).))……
RS 2 seq AAAAAAUUAAAAAGAAAUGGUUGGGGAAACUGGUUAGAUUCCAGUACAGUGCCGCUACGGUAAGUCCCAAACAUCAACAGGUGUUGGGAACAAGUCCGAUUAUCAAUCAUUUUAAUUUUCCCGAG
RS 2 dot ..((((((((((.((.(((((((((…(((((…….)))))….(((((…))))).(((((.((((((….))))))))).))…)))))))))…)).))))))))))……
RS 3 seq ACCAUAUUUAGUCUCUCGAACCAUUUCUCCUAAAUCCUUAUAAAAGGGCAGGGAGGAUGGUCAAUGGGUAUUUCGAGAAAUCGAAAUGCCUCCCGUGCUCGGAAAGGUGAGAUUAAUUUUUUUGUAA
RS 3 dot …….((((((((….(((.((((((((…(((((….))))).)))(((.((((…..(((((((((((….))))))))))).)))).)))))))))))))))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table