Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067554 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA067554
Gene: MRPL54
MFE: -12.451
ENS: 0.997
Length: 59.
Predicted Ligands:
glutamine - 11/20
fluoride - 6/20
SAM - 1/20
 RS: URS0000C513F0_1734399
MFE: -17.330
Ligand: fluoride
Species: Clostridia bacterium BRH_c25 Fluoride riboswitch
 RS: URS0000BF68D1_65393
MFE: -15.126
Ligand: glutamine
Species: Cyanothece sp. PCC 7424 Glutamine riboswitch
 RS: URS0000D696BA_12908
MFE: -19.232
Ligand: SAM
Species: unclassified sequences SAM-VI riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067554 URS0000C513F0_1734399 URS0000BF68D1_65393 URS0000D696BA_12908
Length 59. 59. 60. 60.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.997 - - -
MFE -12.451 -17.330 -15.126 -19.232
Ligands - fluoride glutamine SAM
Gene MRPL54 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 2.004 2.013
Length SE - 0. 1. 1.
Lev Distance - 13. 13. 13.
UBS 3. 2. 3. 2.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.254 0.288 0.317 0.367

Sequences

Field Description
UTR seq + 25 gaaacgugcacuugcaagcugcccgcaauacgucATGGCGACCAAACGCCTTTTCGGGG
UTR dot + 25 …(((((…((((………)))))))))…((((……))))………
RS 1 seq AAUAGUUAUGGUGAUGGGGCUCACCAUAACCGCUGUAAGCUGAUGGCUCCUAUUUUGAC
RS 1 dot ….((((((((((……)))))))))).(((((……)))))…………
RS 2 seq AUCGUUCAUCCUUCUAGUUUUGGAGGACGGAAGUAGGGAAAAAUCCCGAAGGAACGCGCU
RS 2 dot .((((((.(((……….)))))))))…..((((….))))………….
RS 3 seq CGUAUCAGUGUGCCUCGCAUCCCGCGGGGCGAUAAGUCCUGAAGAAAGGGAUGAUAUGAC
RS 3 dot ……….((((((((…..))))))))….(((((…….)))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table