Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067583 Similarity: 0.988 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA067583
Gene: MRPS10
MFE: -29.151
ENS: 0.991
Length: 71.
Predicted Ligands:
homocysteine - 6/20
aminoglycoside - 3/20
fluoride - 3/20
 RS: URS0000AB1A13_257314
MFE: -16.931
Ligand: SAM
Species: Lactobacillus johnsonii NCC 533 SMK box translational riboswitch (SAM-III)
 RS: URS0002318D4E_113562
MFE: -28.876
Ligand: cobalamin
Species: Actinoplanes derwentensis Cobalamin riboswitch
 RS: URS0000E5FE5F_688245
MFE: -19.268
Ligand: aminoglycoside
Species: Comamonas testosteroni CNB-2 putative aminoglycoside riboswitch / attI site
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067583 URS0000AB1A13_257314 URS0002318D4E_113562 URS0000E5FE5F_688245
Length 71. 71. 71. 72.
Similarity - 0.988 0.986 0.986
Ensemble Norm 0.991 - - -
MFE -29.151 -16.931 -28.876 -19.268
Ligands - SAM cobalamin aminoglycoside
Gene MRPS10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2.001 4.002
Length SE - 0. 0. 1.
Lev Distance - 16. 18. 17.
UBS 4. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 1. 2. 2. 2.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 1.
UN 0.056 0.042 0.085 0.097

Sequences

Field Description
UTR seq + 25 gccgcuguaaccccggaagcaauccugagaggucgggaccggcaagATGGCGGCGCGGACAGCGTTCGGTG
UTR dot + 25 ((((((((….((((……((((((….))))))))))….)))))))).(((((…)))))…
RS 1 seq UUCGGUUAAGGUCCCGAAAGGAUUCGUUUUUAACGAAGAUGCCUUGUAACCGAAAGAUGGGGGACUCUAUG
RS 1 dot ((((((((((((…….(..((((((…))))))..)))))..))))))))..(((((….))))).
RS 2 seq GAGGAAGCCGGUGUGAGUCCGGCGCGGUCCCGCCACUGUCACCAGGGUUUUCUCCUGGCAGCCAGGAACUC
RS 2 dot (((((((((((((..(((..((((……)))))))..))))..)))))))))((((…))))……
RS 3 seq GGAGCAGUAACAAUGUUACGCAGCAGGGCAGUCGCCCUAAAAACAAAGUUAGGCUAAGGCAAUCUCGCCAAG
RS 3 dot ..(((..((((..((((…….(((((….)))))…))))..)))).)))..(((……)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table