Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067605 Similarity: 0.950 Similarity: 0.950 Similarity: 0.950
UTR: 5HSAA067605
Gene: MRPS15
MFE: -77.194
ENS: 0.916
Length: 189.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231760E_1897044
MFE: -47.274
Ligand: cobalamin
Species: Clostridiales bacterium 41_21_two_genomes Cobalamin riboswitch
 RS: URS000232CFC9_657313
MFE: -46.974
Ligand: cobalamin
Species: Ruminococcus torques L2-14 Cobalamin riboswitch
 RS: URS0002316084_1922337
MFE: -54.091
Ligand: cobalamin
Species: Leptolyngbya sp. 'hensonii' Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067605 URS000231760E_1897044 URS000232CFC9_657313 URS0002316084_1922337
Length 189. 189. 189. 189.
Similarity - 0.950 0.950 0.950
Ensemble Norm 0.916 - - -
MFE -77.194 -47.274 -46.974 -54.091
Ligands - cobalamin cobalamin cobalamin
Gene MRPS15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.008 5.008 15.
Length SE - 0. 0. 0.
Lev Distance - 64. 64. 58.
UBS 15. 15. 15. 13.
BS 0. 0. 0. 0.
ILL 5. 6. 6. 7.
ILR 3. 2. 2. 2.
H 3. 2. 2. 2.
BL 6. 7. 7. 4.
BR 4. 5. 5. 3.
UN 0.021 0.111 0.111 0.021

Sequences

Field Description
UTR seq + 25 gagucacgccaccuaauccauucucucggucuucgucugcuccgguauugcaacugccucgauuggucgauccugggccagcauggcggcgcccauguaacccgguccgugccgcaaagcgaacggcggccgcggcgcgggccccgcggggguuagaggucaccATGCTGAGGGTCGCGTGGAGGACGC
UTR dot + 25 ((((.(((..(((…………..)))…)))..))))((((……))))((((.((..(.(((((((….((((((((.(((.(…(.((((((((((((((((((…((……..)).))))))))))))……)))))).))))).)))))))))))))))))).))))….
RS 1 seq UGAUUAUGAAUGAUCAGAGGAACGACGUGGGAAAUCUGGACUGGUGAAAAGGGAAACAGGUGAGAAUCCUGUACGAACUCGUCACCGUAUUUCGUGAGCUUGUGUUUUGAGGCCACUGGGAGACCGGGAAGGUGAAGCAGAAGCAUUUGAACGAUCAGCCGGGAGACCUGCCUUUCGCAGUACAGGAAU
RS 1 dot ((((((….))))))………………((((.(((.(((.(((((….(((((…..(((((…((..((((………(((.(.((((.((((((…(((.((((….))))…))))))))).)))).).)))))))))…))))).)))))))))))))))).))))…
RS 2 seq UGAUUAUGAAUGAUCAGAGGAACGACGUGGGAAAUCUGGACUGGUGAAAAGGGAAACAGGUGAGAAUCCUGUACGAACUCGUCACCGUAUUUCGUGAGCUUGUGUUUUGAGACCACUGGGAGACCGGGAAGGUGAAGCAGAAGCAUUUGAACGAUCAGCCGGGAGACCUGCCUUUCGCAGUACAGGAAU
RS 2 dot ((((((….))))))………………((((.(((.(((.(((((….(((((…..(((((…((..((((………(((.(.((((.((((((…(((.((((….))))…))))))))).)))).).)))))))))…))))).)))))))))))))))).))))…
RS 3 seq GAACAAUCUGCGGCUUAUGUUAAACUUCAUAAGCCUGGGUUGGGAAAGUCCGGUGAAAGUCCGGCACUGUGCCGCAACUGUAAUUUGAAUUCAAAAUUAAGCAUUCAAAAUUAAAACUUGAAUCGGUGAGUUGAAUUUUGAAUUUUGAAUUGAUCAAGUCAGAAUGCCAGUCCUGGUCACUCAAGUCCA
RS 3 dot …(((((((.((((((((……..)))))))))))))))(((……(((((….((((.((((.((…..(((..((((((..((((..(((((.((((((((((..(((((……..))))).))))))))))))))).)))))))))))))…)))))).)))))))))….))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table