Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067622 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA067622
Gene: MRPS17_0
MFE: -14.188
ENS: 0.979
Length: 63.
Predicted Ligands:
fluoride - 7/20
homocysteine - 6/20
SAM - 4/20
RS: URS0000C56965_12908
MFE: -11.238
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
RS: URS0000C46045_1526735
MFE: -27.654
Ligand: homocysteine
Species: Vogesella sp. EB S-adenosyl-L-homocysteine riboswitch
RS: URS0000C3E556_281362
MFE: -16.482
Ligand: homocysteine
Species: Dechloromonas denitrificans S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067622 URS0000C56965_12908 URS0000C46045_1526735 URS0000C3E556_281362
Length 63. 61. 64. 62.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.979 - - -
MFE -14.188 -11.238 -27.654 -16.482
Ligands - glutamine homocysteine homocysteine
Gene MRPS17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 6.002 3.013
Length SE - 4. 1. 1.
Lev Distance - 11. 15. 17.
UBS 5. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 3. 2. 1. 2.
H 1. 1. 1. 1.
BL 1. 1. 1. 1.
BR 0. 0. 1. 1.
UN 0.063 0.098 0.109 0.177

Sequences

Field Description
UTR seq + 25 gaggugagucucgugguggaggugaccaaagccacguaATGTCCGTAGTTCGCTCATCCGTCC
UTR dot + 25 (.(((((((((((((((((……))…))))))……….))…))))))))….
RS 1 seq AUCGUUCAUCCUUAUUUUUGGGGACGGAAGUAGGUAAAAAAUCAAACCGAAGGAACGCAUC
RS 1 dot ..(((((.((((((((((((….))))))))))…………..))..)))))….
RS 2 seq GAUUCCGGGGAGCGCUGCGAGGCCAUGCCCCAGGCCCGGAAACGCAAAACGGCGCUCACCUGCU
RS 2 dot …..((((((((((((((.((((……..))))))………..)))))))).))))..
RS 3 seq CCUACCGAGGGGCGCUGCAGGAGAACACUCCCAGGCUCGGUUUAAAACGGCGCUCACUGAUC
RS 3 dot …….(((((((((((.((((….))))…))…………))))))).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table