Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067632 Similarity: 0.990 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA067632
Gene: MRPS18B
MFE: -11.772
ENS: 0.927
Length: 39.
Predicted Ligands:
SAM - 17/20
fluoride - 1/20
unknown - 1/20
 RS: URS00021EDF1A_12908
MFE: -9.296
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000D92E6B_1802287
MFE: -9.182
Ligand: fluoride
Species: Syntrophobacterales bacterium GWC2_56_13 Fluoride riboswitch
 RS: URS00021EDE14_12908
MFE: -11.238
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067632 URS00021EDF1A_12908 URS0000D92E6B_1802287 URS00021EDE14_12908
Length 39. 41. 38. 42.
Similarity - 0.990 0.986 0.985
Ensemble Norm 0.927 - - -
MFE -11.772 -9.296 -9.182 -11.238
Ligands - SAM fluoride SAM
Gene MRPS18B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 4.079 3.009
Length SE - 4. 1. 9.
Lev Distance - 9. 17. 10.
UBS 2. 2. 3. 2.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 0. 1. 1. 1.
H 1. 1. 1. 1.
BL 1. 0. 0. 0.
BR 0. 0. 1. 0.
UN 0.333 0.415 0.053 0.429

Sequences

Field Description
UTR seq + 25 gggcguacgucaagATGGCGGCGTCTGTATTAAACACCG
UTR dot + 25 ((((((.(((((…)))))))))))………….
RS 1 seq CACGCAACGGCUUCCUGACGCGUGAGAUUAAUAUUGGAGCA
RS 1 dot (((((..(((….)))..)))))……………..
RS 2 seq GGGGUUCACCGCAACCGCCGCUCGGCUGAUAACUCCUA
RS 2 dot (((((((((((………..))).)))..)))))..
RS 3 seq GCCACAACGGCUUCCUGGCGUGGCAAUUUUUUUAAUGGAGCG
RS 3 dot (((((..(((….)))..)))))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table