Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067655 Similarity: 0.977 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA067655
Gene: MRPS21
MFE: -20.666
ENS: 0.881
Length: 107.
Predicted Ligands:
TPP - 14/20
fluoride - 2/20
tetrahydrofolate - 1/20
 RS: URS0000D85328_64969
MFE: -32.937
Ligand: TPP
Species: Oceanospirillum multiglobuliferum TPP riboswitch (THI element)
 RS: URS0000D8DFDF_1123404
MFE: -22.221
Ligand: TPP
Species: Tissierella praeacuta DSM 18095 TPP riboswitch (THI element)
 RS: URS0000D81C9A_1914540
MFE: -26.059
Ligand: TPP
Species: Bacillus obstructivus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067655 URS0000D85328_64969 URS0000D8DFDF_1123404 URS0000D81C9A_1914540
Length 107. 107. 109. 107.
Similarity - 0.977 0.975 0.974
Ensemble Norm 0.881 - - -
MFE -20.666 -32.937 -22.221 -26.059
Ligands - TPP TPP TPP
Gene MRPS21 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 1.007 5.007
Length SE - 0. 4. 0.
Lev Distance - 30. 29. 33.
UBS 8. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 2. 2. 2. 1.
H 3. 4. 3. 4.
BL 1. 2. 1. 2.
BR 2. 1. 2. 3.
UN 0.075 0.121 0.156 0.159

Sequences

Field Description
UTR seq + 25 gcuuccgguagugagaacccuuccggugggcuagguacugagcgcgcgaggcucuacagagugaagguuuaaauccaaggucATGGCAAAACATCTGAAGTTCATCG
UTR dot + 25 ((((((((.((……..)).)))).))))…(((..((((…….)))))))…((((((((……(((……)))……))))…..))))..
RS 1 seq ACAGUCUUGACGGGGUGCAAUGGUAGGCUGAGAUCACUGCAAUAGCGGUGAAACCCGACGAACCUGAACUGGGUAAUGCCAGCGUAGGAAUCGAGCAACAGUGUGCG
RS 1 dot .((((((..((.(…….).))))))))…(((((((….)))))))…….(((.((((..((((……))))..))))..))).(((……))).
RS 2 seq AGUAAUGUAAAGGGGUGCUUAUAUUAAUAGGCUGAGAUAGGAAUGUUAUUUCUGACCCUAAGAACCUGAUUUGGGUAAUUCCAACGGAGGGAUUUGGCUAAUUUGUUAU
RS 2 dot ..((((((((……..))))))))…(((.(((((((…..))))))).).))(((((..(((…(((((….)))))…)))..)))))…………
RS 3 seq AGAUUCUGCUAGGGGAGCCGAGUUUGGCUGAGAGAGAUCAAAGAAGAUUGAUACCCUUUAAACCUGAUCCGGGUGAUGCCGGCGUAGGGAAGCGGUCCAAACCUAUU
RS 3 dot ((((((.(((…..))).))))))…..((((.((((((……))))).).))))…((((..((((……))))..))))…..(((….)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table