Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067690 Similarity: 0.988 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA067690
Gene: MRPS27
MFE: -12.344
ENS: 0.891
Length: 63.
Predicted Ligands:
fluoride - 16/20
unknown - 3/20
cobalamin - 1/20
 RS: URS0000D8A52F_1121390
MFE: -24.940
Ligand: fluoride
Species: Desulfacinum hydrothermale DSM 13146 Fluoride riboswitch
 RS: URS0000C88A55_1294143
MFE: -19.182
Ligand: fluoride
Species: Pseudomonas denitrificans ATCC 13867 Fluoride riboswitch
 RS: URS0000C1E884_1470557
MFE: -19.054
Ligand: fluoride
Species: Streptomyces sp. Tu 6176 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067690 URS0000D8A52F_1121390 URS0000C88A55_1294143 URS0000C1E884_1470557
Length 63. 63. 63. 64.
Similarity - 0.988 0.987 0.986
Ensemble Norm 0.891 - - -
MFE -12.344 -24.940 -19.182 -19.054
Ligands - fluoride fluoride fluoride
Gene MRPS27 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 5.006 2.
Length SE - 0. 0. 1.
Lev Distance - 15. 16. 17.
UBS 6. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 1. 0. 2.
BR 1. 1. 1. 1.
UN 0.095 0.095 0.175 0.109

Sequences

Field Description
UTR seq + 25 ccguaacccguuggcuguuccuuuugguacgcuccaagATGGATAAAACATTTGAGAGAAAGT
UTR dot + 25 .(((.(((.(..((…..))..).))))))(((..(((((…….)))))..)))…..
RS 1 seq UGCGAUCUAGGCGAUGAGGCUCGCCUUGGAACCGCCCUUCGGGCUGAUGGCCUCUAGGGAAGC
RS 1 dot ..((.(((((((((……))))).))))..))((((..(((((…)))))..))))….
RS 2 seq UGCGCGGCAGGAGAUGGCAUUCCUCCUUCAACCGCCCUCGUGGCUGAUGAUGCCUACGCAUAA
RS 2 dot …((((..((((..((….))..))))..))))…((((((…….))).)))…..
RS 3 seq GACGGAGACGGCGAUGAGGCUCGCCCUUGACCGCACACCCCGUGCUGAUGGCCUCUGUGAACGA
RS 3 dot ..(((.((.(((((……))))).))..)))((((..((((….))))….))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table