Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA067969 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA067969
Gene: MSH4
MFE: -17.396
ENS: 0.535
Length: 66.
Predicted Ligands:
fluoride - 13/20
glutamine - 3/20
GMP - 1/20
 RS: URS0000DB6973_243061
MFE: -25.125
Ligand: fluoride
Species: Mycobacterium sherrisii Fluoride riboswitch
 RS: URS0000C65CAC_1048983
MFE: -12.944
Ligand: fluoride
Species: Cytophagaceae bacterium ANESC-S Fluoride riboswitch
 RS: URS0000DB329A_243061
MFE: -22.134
Ligand: fluoride
Species: Mycobacterium sherrisii Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA067969 URS0000DB6973_243061 URS0000C65CAC_1048983 URS0000DB329A_243061
Length 66. 65. 66. 65.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.535 - - -
MFE -17.396 -25.125 -12.944 -22.134
Ligands - fluoride fluoride fluoride
Gene MSH4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.002 12.001 7.
Length SE - 1. 0. 1.
Lev Distance - 13. 16. 17.
UBS 4. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 0. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 3. 3. 2.
BR 3. 2. 3. 2.
UN 0.182 0.231 0.212 0.

Sequences

Field Description
UTR seq + 25 cagaaaccucauacuucucgggucagggaagguuugggaggATGCTGAGGCCTGAGATCTCATCAA
UTR dot + 25 (((…((((((((((((((((((……))))))))))).)).))))).)))…………
RS 1 seq UUCGCGGUCGGCGAUGAGGCUCCGCCCGCUACGCGUCGCCCGACGCUGAUGGCUUCUACCCCGCA
RS 1 dot …((.(((((((.((.(((..(((…….)))..))))).))))))).))…………
RS 2 seq AUCAUUAUAGGUGAUGGGGUUCCACCUUUAACCGCGCAAACAGCUGCUGAUGACUCCUACUUCAAC
RS 2 dot .(((((((((.((.((.((((……..)))).))….)).))).))))))………….
RS 3 seq UUAGCGGUCGGCGAUGAGGCUCCGCCCCCUUCGCGUCAUCUGACGCUGAUGGCUUCUACCCCGCA
RS 3 dot ..(((.(((((((((((.((…………)).)))))….)))))).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table