Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068073 Similarity: 0.947 Similarity: 0.947 Similarity: 0.945
UTR: 5HSAA068073
Gene: MSN
MFE: -38.353
ENS: 0.675
Length: 158.
Predicted Ligands:
FMN - 8/20
cobalamin - 5/20
glucosamine - 3/20
RS: URS0000AB7DF9_626418
MFE: -58.152
Ligand: FMN
Species: Burkholderia glumae BGR1 FMN riboswitch (RFN element)
RS: URS0000C5F770_1632865
MFE: -56.690
Ligand: glycine
Species: Pirellula sp. SH-Sr6A Glycine riboswitch
RS: URS0000C8240F_1538553
MFE: -55.640
Ligand: FMN
Species: Methylomonas denitrificans FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068073 URS0000AB7DF9_626418 URS0000C5F770_1632865 URS0000C8240F_1538553
Length 158. 158. 157. 159.
Similarity - 0.947 0.947 0.945
Ensemble Norm 0.675 - - -
MFE -38.353 -58.152 -56.690 -55.640
Ligands - FMN glycine FMN
Gene MSN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 14. 5.001
Length SE - 0. 1. 1.
Lev Distance - 64. 61. 69.
UBS 16. 15. 14. 15.
BS 0. 0. 0. 0.
ILL 3. 1. 4. 3.
ILR 3. 3. 2. 2.
H 5. 4. 3. 4.
BL 6. 5. 6. 5.
BR 6. 8. 8. 7.
UN 0.057 0.089 0.057 0.031

Sequences

Field Description
UTR seq + 25 agucgccccgacgcuagugagggacccaaucugaguccccggccagccgaauccaagccguguguacugcgugcucagcacugcccgacaguccuagcuaaacuucgccaacuccgcugccuuugccgccaccATGCCCAAAACGATCAGTGTGCGTG
UTR dot + 25 .((((…))))(((.((..(((((.((…)).)))))..)).)))((((….(((…(.(.((((((.((……..)).)).))))))..)))….))))……..((.((….)).))((((((((…………))))).)))
RS 1 seq GAACGUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAUCAUGCUCCGCGCAUGUAGCCCGCGAACAGCUCGCCUCGGGUGCGCCCGACGCGAUGCCUGCCGACCCGGUGCGAUUCCGGGGCCGACGGUCAUAGUCCGGAUGAGAGAGAGCGGGG
RS 1 dot …(((.(((((.((((((((..(((((((…)).)).)))..)))))))).).)).))…)))….((((((.(((((….))))).)))).))(((.((.(((((…….)))))..)).)))……((((…………)))).
RS 2 seq UUAUUCAUCUCUGGAGAGCGGUCUUGUUCGAUCAAGACCCACCGAAGGGGAAAGACUUUAUCGCACGGCAAUGCCAUCUCUGGUUAUCGCAAUCAGGGGAUGGGAAUGCCGGUCGAGCGGGUCGAGAUCUCUCAGGUAAAGGGACAGAGGGGCCAGC
RS 2 dot …(((.(((.(((…(.(((((((……)))))))).))).))).))).(((((..(((..(((((.(.((((((((((((…..)))))))).)))).).)))))..)))..)))))..(.((((((..((……)).)))))).)…
RS 3 seq GCUUGUACUCAGGGCGGGGCGGAAUUCCCCACCGGCGGUAUCUCGGGGUUGACUCGGGGAGCCCGCGAGCGCCGCAAUCGCAGUUGUUGAGAAUGCGGGUCAGCAGAUCCGGUGAGAUGCCGGAGCCGACGGUCAUAGUCCGGAUGAAAGAGAACAGCG
RS 3 dot .((((….)))).(((((.((….)))).)))(((((..(((((((((………))))).)))).)))))…(((.(((.((….((.((((((.((…((((((…..)))))))).)))………))).))….)).))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table