Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068261 Similarity: 0.978 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA068261
Gene: MTBP_0
MFE: -25.276
ENS: 0.818
Length: 98.
Predicted Ligands:
TPP - 8/20
SAM - 4/20
glycine - 3/20
 RS: URS0002333F55_1798497
MFE: -23.046
Ligand: SAM
Species: Candidatus Kaiserbacteria bacterium RIFCSPHIGHO2_02_FULL_55_20 SAM riboswitch (S box leader)
 RS: URS0000C5EE69_1144300
MFE: -19.141
Ligand: purine
Species: Lactobacillus gastricus PS3 Purine riboswitch
 RS: URS0000C73A71_1494608
MFE: -33.905
Ligand: TPP
Species: Arthrobacter sp. PAMC 25486 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068261 URS0002333F55_1798497 URS0000C5EE69_1144300 URS0000C73A71_1494608
Length 98. 98. 98. 99.
Similarity - 0.978 0.978 0.978
Ensemble Norm 0.818 - - -
MFE -25.276 -23.046 -19.141 -33.905
Ligands - SAM purine TPP
Gene MTBP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 4.001 9.
Length SE - 0. 0. 1.
Lev Distance - 28. 28. 25.
UBS 7. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 4.
ILR 1. 2. 0. 2.
H 3. 3. 3. 3.
BL 2. 3. 3. 2.
BR 2. 2. 3. 2.
UN 0.071 0.102 0.041 0.061

Sequences

Field Description
UTR seq + 25 gaaaugcgucauagcgcgcgucuguuuggauguggaagccgagaccuaaaguuggggggugaucucugaggagATGGATCGGTACCTGCTGCTGGTGA
UTR dot + 25 ….(((((….)))))(((((.((((((….((.(((….((((….)))).)))..)))))))).))))).(((((((…..)))))))..
RS 1 seq UACGUAUCAAGAGUGCGACGAGAGUUCCGGCUUUAUGACUCGCCAGCAACCUGCCGAAGGUAAGGUGCUCCAUCCGGCCCCUAGCGGGAAGAUGCUUU
RS 1 dot ..(((((…..)))))….((((.((.((((……(((.(((….))).)))))))..)).))))((((…(((…..)))..))))….
RS 2 seq UUUAUUGAACACAAUAUUACUUAUAUAUCGCCACAUGAUGGGUGGCCGUUUCUACCUGAAACCGUUCUUUUCAGACUAUAAGUAAACAGCGCGGCUGG
RS 2 dot ..(((((….)))))(((((((((..((……(((.(((.(((.(((((…..))))).)))))).))))).))))))))).((((…)))).
RS 3 seq GAGCGUGACACGGGGUGCCAGGCCACAAGGGCCGGCUGAGACAAUACCCGUUGAACCUGCCCGGCUAGCACCGGCGAAGGGAUGUCCCAUGAGCGCCAC
RS 3 dot …(((…))).(((((..((((….((((.((.(..(((…….)))..))).)))))))).)))))((((..(((….)))…..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table