Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068334 Similarity: 0.987 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA068334
Gene: MTHFD1
MFE: -20.448
ENS: 0.779
Length: 78.
Predicted Ligands:
homocysteine - 10/20
zmp-ztp - 4/20
cobalamin - 2/20
 RS: URS00023150EA_1541959
MFE: -7.849
Ligand: cobalamin
Species: Candidatus Izimaplasma sp. HR1 AdoCbl variant RNA
 RS: URS000231C4D2_1802032
MFE: -16.594
Ligand: cobalamin
Species: Candidatus Roizmanbacteria bacterium RIFCSPHIGHO2_01_FULL_39_24 AdoCbl variant RNA
 RS: URS0000C10E4A_1348657
MFE: -24.101
Ligand: homocysteine
Species: Thauera terpenica 58Eu S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068334 URS00023150EA_1541959 URS000231C4D2_1802032 URS0000C10E4A_1348657
Length 78. 76. 79. 77.
Similarity - 0.987 0.985 0.984
Ensemble Norm 0.779 - - -
MFE -20.448 -7.849 -16.594 -24.101
Ligands - cobalamin cobalamin homocysteine
Gene MTHFD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.005 5.007 8.001
Length SE - 4. 1. 1.
Lev Distance - 11. 18. 18.
UBS 6. 6. 5. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 1. 1. 2. 0.
H 2. 1. 1. 2.
BL 1. 2. 2. 3.
BR 2. 3. 1. 1.
UN 0.192 0.263 0.278 0.169

Sequences

Field Description
UTR seq + 25 guggaaccucgauauuggugguguccaucgugggcagcggacuaauaaaggccATGGCGCCAGCAGAAATCCTGAACG
UTR dot + 25 ((((..(((…((((((((.((((((…)))))).)..))))))).))))))).((….))…………..
RS 1 seq UAACUAAGUAAAUUGAGGAAAUAGGCGCAACUCCUAUGCUACCCCAGUAACUGUUAAAGUCAGAUACUCAAAAUUA
RS 1 dot ((((..(((..((((.((..(((((.(…).)))))….)).)))).)))))))………………..
RS 2 seq AAUUUUACUUAGUGCUGGGGAAGCAGGUGUGAUUCCUGCAGUGUGCCGCAACGGUGAAACUCCGAAUACCGACUAAGUG
RS 2 dot ..(((((((…(((.((.(..(((((…….)))))….).)))))..)))))))………………..
RS 3 seq CUUGCCGAGGAGCGUUGCGACCCCGAUCAGAAAUUCGCGGGCCAGGCUCGGCAACCGAUCAACGGCGCUCACAAACC
RS 3 dot .(((((…((((.(((.(.((((((……..))).))))))))))))))))(((…..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table