Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068408 Similarity: 0.978 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA068408
Gene: MTHFR
MFE: -28.322
ENS: 0.897
Length: 97.
Predicted Ligands:
TPP - 10/20
glycine - 6/20
SAM - 3/20
 RS: URS0000BE8D2A_1262883
MFE: -21.319
Ligand: TPP
Species: Eubacterium sp. CAG:192 TPP riboswitch (THI element)
 RS: URS0000C4C5D6_889306
MFE: -25.679
Ligand: SAM
Species: 'Jeotgalibacillus soli' Cunha et al. 2011 SAM riboswitch (S box leader)
 RS: URS0000DAE9ED_1523422
MFE: -35.299
Ligand: glycine
Species: Brevundimonas sp. AAP58 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068408 URS0000BE8D2A_1262883 URS0000C4C5D6_889306 URS0000DAE9ED_1523422
Length 97. 97. 97. 96.
Similarity - 0.978 0.977 0.976
Ensemble Norm 0.897 - - -
MFE -28.322 -21.319 -25.679 -35.299
Ligands - TPP SAM glycine
Gene MTHFR - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 6.004 2.001
Length SE - 0. 0. 1.
Lev Distance - 29. 29. 30.
UBS 8. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 0. 1.
ILR 2. 1. 1. 2.
H 4. 4. 4. 4.
BL 1. 2. 1. 1.
BR 1. 1. 1. 1.
UN 0.113 0.124 0.175 0.083

Sequences

Field Description
UTR seq + 25 cuaccguacccaggagugggacgaguucccuaacggccgcugagcaagucccccaaggaggagcugcugaagATGGACCATCGAAAAGCCAGGGTCC
UTR dot + 25 ….(((.((((….)))))))(((..((….))..))).((((..(((((…)).)))..))))……(((((………….)))))
RS 1 seq AUAUGUCGCUAGGGGUGCCGGAUGGCUGAGAGAUGUAUAUCGAUCCUCACUACUUGAUAUGGUUAGUACCAUCGUAAGGAAGCAUUUAGUUAUGUAU
RS 1 dot ….((((((.((….)))).))))((((.(((……..)))))))…((((..(((((….)))))..))))…((((……))))..
RS 2 seq UUUCUAUCUAGAGAGGUGGAGGGACAGGCCCUGUGAAAUCUCGGCAACAGCAUUUUGACUGUGCCAAUUCCUGCAAGUUUUACUUGGAAGAUAGGAG
RS 2 dot …((((((….))))))((((…..))))……….(((.((((((…)).)))))))…((((((((((…)))))…..))))).
RS 3 seq GUCGCUCUCGCGGGAGAGAUCGGCCCAUCGCUACGGGCCGGAGCCGAAGGCGCAACCGCCCCGGAAACGCUCAGGCAAAAGGACCGCGAGGACGUU
RS 3 dot ….(((((….))))).(((((((……..)))))))..(((..((((….)))).))).(((((((.((……..))..)))..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table