Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068426 Similarity: 0.928 Similarity: 0.921 Similarity: 0.917
UTR: 5HSAA068426
Gene: MTHFSD
MFE: -87.946
ENS: 0.846
Length: 243.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS0000C9E904_1331910
MFE: -108.633
Ligand: cobalamin
Species: Thermogutta terrifontis Cobalamin riboswitch
 RS: URS00023353AD_1232683
MFE: -94.528
Ligand: cobalamin
Species: Marinobacterium sp. AK27 Cobalamin riboswitch
 RS: URS000232ACC6_1805002
MFE: -88.235
Ligand: cobalamin
Species: Anaerolineae bacterium CG1_02_58_13 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068426 URS0000C9E904_1331910 URS00023353AD_1232683 URS000232ACC6_1805002
Length 243. 245. 241. 240.
Similarity - 0.928 0.921 0.917
Ensemble Norm 0.846 - - -
MFE -87.946 -108.633 -94.528 -88.235
Ligands - cobalamin cobalamin cobalamin
Gene MTHFSD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 13. 17.002
Length SE - 4. 4. 9.
Lev Distance - 88. 91. 85.
UBS 14. 14. 12. 13.
BS 5. 4. 7. 4.
ILL 5. 5. 3. 5.
ILR 3. 3. 3. 5.
H 4. 3. 4. 3.
BL 3. 4. 4. 6.
BR 6. 6. 6. 5.
UN 0.091 0.065 0.108 0.046

Sequences

Field Description
UTR seq + 25 gguucgggucgaaccagcggcucucucgcccggaaucccgagaaagaugucaggaaaaauaaagauaacgagaagacgaggcgggagggacaccugccgugcacgugggggagcccgugggccccuugaggucggggaaacugaggcucaggaacaggaucggaagccgguuugaccuacacgcgggggucgcuuaacuacuguuaagcgguuucagcATGGAGCCGAGGGCAGGTGTCTCCA
UTR dot + 25 ((((((…))))))……..(((((((((…((.((…….(((……..)))…….)).))…)).)))))))((((((((((((.(((.((((..((((((….(((((((((((((((….((((..(((((..((……)).)).))))))))))))).))…)))))))(((((((….)))))))))))))..))))..))..).))))))))))))..
RS 1 seq AUGAUGGCGUUGGGCGUUGGUGUCCGGCCGGACGGCUUGUCUGGUCGGGUAACAGGGAAUCCGGUGCAAAUCCGGAACGGUCCCCGCCGCUGUGACCGGACGUUACCAGACCCGCCCAGUCUCCUUGGCCAUUGUCGCGGCCUAAAGCCCUUGGCGGUCUUGAUCGCCGAGGGCGAUUGCGACGAGAAGGCCGGGUUGGGUCGAGUCCGGAAGUCAGAAGACCUACCAACGCAGGACUGUCGGUC
RS 1 dot ….(((((((..((((((((((((((((((((…..)))))))))(((….((((.(((((…….)))))….)))).))).((((..((((((.(…..(((((((((………((((.(((((((((.(….((((((((((((….))))))))))))).)))))))))…)))))))).)))))).))))))..).)))..)))..))))))))..))).))))…
RS 2 seq AAUUGCGCCCAUGCUUUUGGUGAGCCAGGCCUUUGCAGAGAUGCAGGUCUGGAACUUAAUCGGGAAGCCGGUGCGUGAAACCCCAGGGUUUCGCAAUGCCGGCGCUGCCCCCGCAACGGUAGAGGAGUGGGAACAGCCUAAGCCACUGUAUCGCAGGAUAUGGGAAGGCGCUGUUCUUGGAUGCAGGCGAUGCCUGAAUCGACUCCUGAGCCCGGAGACCGGCCAGAAGCGUUAGCAGUCG
RS 2 dot ….(((((…((((((.((((((((((((..((((….)))))))))))..))))..).)))))).)))))(((((((……)))))))..(((.(((((((((((((….(((..(((((((((((((((….(((.(((((((….)))))))…)))))))))))).(((.(((((…))))).))).))))))..)))))).)…)))….)))))).)))….
RS 3 seq GCCAAUCGAAUAUCGGCCAGUCCGCGGCGAAGCCGGUGCAAUUCCGGCGCUGUCCCGCAACUGUGAAUUUAGUUAGGUAGUUGGAUAGUUACGUAGUUGGAUAGUUACGUAGUUAUGUAGUUGGAUAGUUAAAUAGUUGGGUAGUUUGAUGUUCAACUACCAAACUACCAAACUACAAAACUACAAAACUACCAAACUACCAAACUAAAUGAGUCAGGUCGCCCGCGCUGGUCGGUUCGC
RS 3 dot ……(((..((((((((((.((.(((((.(((((…….)))))((……))..((((..((((((((.(((((((((.(((((..((((((…(((((..((((((..(((((((((((.((((((………)))))))))))))))))..))))))..)))))…))))))..))))))))).))))).))))))))..).))).))))))).))))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table