Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068655 Similarity: 0.945 Similarity: 0.945 Similarity: 0.943
UTR: 5HSAA068655
Gene: MTNR1A
MFE: -52.878
ENS: 0.832
Length: 181.
Predicted Ligands:
lysine - 11/20
FMN - 4/20
cobalamin - 3/20
 RS: URS0000C1D7AB_767434
MFE: -80.494
Ligand: FMN
Species: Frateuria aurantia DSM 6220 FMN riboswitch (RFN element)
 RS: URS0000ABCAAE_1045855
MFE: -74.683
Ligand: FMN
Species: Pseudoxanthomonas spadix BD-a59 FMN riboswitch (RFN element)
 RS: URS000231F45D_448385
MFE: -72.446
Ligand: cobalamin
Species: Sorangium cellulosum 'So ce 56' Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068655 URS0000C1D7AB_767434 URS0000ABCAAE_1045855 URS000231F45D_448385
Length 181. 183. 178. 181.
Similarity - 0.945 0.945 0.943
Ensemble Norm 0.832 - - -
MFE -52.878 -80.494 -74.683 -72.446
Ligands - FMN FMN cobalamin
Gene MTNR1A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 5.003 9.001
Length SE - 4. 9. 0.
Lev Distance - 61. 57. 71.
UBS 15. 14. 15. 14.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 2.
ILR 0. 2. 2. 1.
H 6. 6. 6. 7.
BL 6. 4. 5. 5.
BR 5. 4. 5. 3.
UN 0.083 0.120 0.135 0.116

Sequences

Field Description
UTR seq + 25 ccggagcggugcaaggaaaagucuuuucagcuucgcgaaguugacacaauauaaacccacugugcaucgauuaacccucggccaggaaacaucuuuguggugagcuuagcgguggcagaccuggugguggccauuuauccguacccguuggugcugATGCAGGGCAACGGCAGCGCGCTGC
UTR dot + 25 .((((((..((.(((((….))))).))))))))(((…((.((((…………)))))))))…….(((.((((.(((…..))).)))))))……((((((..(((….))).)))))).(((.(((((….))))).)))((((.((………)).))))
RS 1 seq UGACGUCUUCAGGGCGGGGUGUGAUUCCCCACCGGCGGUAGGCGUCCAGCCCGUCUCGACGGGUCGGAUGCGAGCCCGCGAGCGCUUUCCGAUGAGGGAAAGGUCAGCAGAUCCGGUCAGAUGCCGGAGCCGACGGUAGGAAACCGAUAGGUUUCCUGAAAGUCCGGAUGAAAGAAGACGGCU
RS 1 dot …………((.((((…….)))).)).(((((..((((((.((((((….)))))).))))))..))).))…..((((((……))))))(((.((…((((((…..)))))))).)))..(((((((((….)))))))))..((.(((..(……)..)))))
RS 2 seq GAACGUCUUCAGGGCGGGGUGCGAUUCCCCACCGGCGGUAGGUGCGCCUGGCGCGCACGAGCCCGCGAGCGCUGCGAGGGGGUGACGCCCACGCAGGUCAGCAGAUCCGGUCCGAUGCCGGAGCCGACGGUUGGUGCCGCAUCCCGGCGCCAGAAAGUCCGGAUGAAAGAAGACGACC
RS 2 dot …………((.((((…….)))).)).(((((..((((((…..))))))..))).))…..(((((.(((.(…).))).)))))(((.((…((((((…..)))))))).)))..(((((((((…..)))))))))…((.((..(……)..)))).
RS 3 seq UGCUGGUGCCCGGGCGUUCGCCUGGGCCGAAGAGGGAACCCGGUGAAACUCCGGGGCUGCCCCGCAGCGGUAAGCGAGAACGACCUCCACCCCAUGCACUGGCCCGCCGAGGGCUGGGAAGCGGUGGACAGUAGGAAUCCGGUCAGACCGGAGCGCUCGCGAGCCCGAAGACCUGCCAGCG
RS 3 dot …(.(.((((((((….))))))))).)……..(((((…….)))))(((((…)))))(((…((….)))))((((((….((.(((((((…..)))))))…))))))))………((((((…)))))).((((.(((.(……..).))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table