Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068696 Similarity: 0.956 Similarity: 0.955 Similarity: 0.955
UTR: 5HSAA068696
Gene: MTRF1L
MFE: -60.448
ENS: 0.793
Length: 155.
Predicted Ligands:
cobalamin - 8/20
FMN - 5/20
glycine - 2/20
 RS: URS0000DB66D1_1229727
MFE: -64.158
Ligand: cobalamin
Species: Thiobacimonas profunda Cobalamin riboswitch
 RS: URS0000AB5F75_367928
MFE: -39.292
Ligand: FMN
Species: Bifidobacterium adolescentis ATCC 15703 FMN riboswitch (RFN element)
 RS: URS0000AB1733_653045
MFE: -59.882
Ligand: cobalamin
Species: Streptomyces violaceusniger Tu 4113 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068696 URS0000DB66D1_1229727 URS0000AB5F75_367928 URS0000AB1733_653045
Length 155. 154. 153. 154.
Similarity - 0.956 0.955 0.955
Ensemble Norm 0.793 - - -
MFE -60.448 -64.158 -39.292 -59.882
Ligands - cobalamin FMN cobalamin
Gene MTRF1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.003 15.016 10.
Length SE - 1. 4. 1.
Lev Distance - 53. 48. 55.
UBS 10. 12. 9. 10.
BS 0. 0. 0. 0.
ILL 5. 4. 2. 4.
ILR 2. 3. 4. 4.
H 4. 5. 4. 3.
BL 1. 3. 2. 3.
BR 1. 2. 1. 1.
UN 0.084 0.136 0.209 0.097

Sequences

Field Description
UTR seq + 25 aaaagcaacgcuugcgcugggcggggcuuggugcgcucucacccuuaucuccaaauucuggguguugucgcgagggcugcuguguccggaacuuccgguuccggucaggguccgcgaucucggacuaaggATGCGGTCCCGGGTTCTGTGGGGCG
UTR dot + 25 ..((((..(((((…..)))))..))))((((……))))……(((….((((((….(((((..(((((.(((…((((((((…)))))))).)))))))))))))))))))….)))….((((((…….)))))).
RS 1 seq GAGGGUGCGCCGCCAUGCGCGGCCGCAGGGAACCGGGUGAAAGGCCCGGACUGCCCCCGCAACUGUAAGCGAAGAGCGCCGAGGAUCAUCCCACUGGCAACCCUGCCGGGAAGGGCCGAGGCGCGGUGAGACGCGAGUCAGGAGACCUGCCCUU
RS 1 dot ….(((.(((((…..)))))))).(((..((((((…..))))))…..)))(((……..)))….(((((..((..(.((((…((((….)))))))).)..))..)))))……..(((.(((….))).)))….
RS 2 seq AGCAAGUUUCAGGGAAGGUGAAAAUCCUUACUGGCGGUAACGGCACGACCGGCAUUCAUAACGGCCCCAUACCGAAGCCCGCGACCCGCGAAAGCGGCUGAUCCGGUGAGAAUCCGGGGCCAACGGUUACAGUCCGGAUGGAAGAAACGGAGC
RS 2 dot ……..((((..((((…….)))).))))((((………))))………..((((((.(((((.((((((((…))))…..))))….)))))…….))))))………..((((..(…..)..))))..
RS 3 seq AGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCACUCUCCCAUCGCCUGUAUGGGGUCACGGCUCGACCGUACGGUUGCUUUCGUACGCGGGGCUGGAAGACCGGGAGGGGCGCGGAUCCGGGAGCCAGGAGACUU
RS 3 dot ……..(((((((.(….((((……))))..).)))))))…((.(((((((………….((((.((((((…(((((((……)))))))..))))))…)))))))))))))..(..(((……..)))..)..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table