Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA068889 Similarity: 0.979 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA068889
Gene: MVD
MFE: -20.756
ENS: 0.996
Length: 88.
Predicted Ligands:
glycine - 7/20
zmp-ztp - 7/20
GMP - 2/20
 RS: URS0000D696EA_12908
MFE: -35.085
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000DA2AAC_734
MFE: -18.625
Ligand: TPP
Species: Haemophilus paracuniculus TPP riboswitch (THI element)
 RS: URS0000C499C1_282197
MFE: -34.672
Ligand: glycine
Species: Jannaschia rubra Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA068889 URS0000D696EA_12908 URS0000DA2AAC_734 URS0000C499C1_282197
Length 88. 88. 89. 88.
Similarity - 0.979 0.978 0.977
Ensemble Norm 0.996 - - -
MFE -20.756 -35.085 -18.625 -34.672
Ligands - GMP TPP glycine
Gene MVD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 15.003 8.
Length SE - 0. 1. 0.
Lev Distance - 26. 22. 27.
UBS 9. 10. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 3.
ILR 3. 4. 4. 2.
H 2. 1. 2. 1.
BL 6. 6. 3. 5.
BR 2. 2. 2. 2.
UN 0.011 0.045 0.067 0.023

Sequences

Field Description
UTR seq + 25 ggucgcccggcgccugcccauuagcgauuaccgaacuaucgaaaucaucaaucaucgauucccATGGCCTCGGAGAAGCCGCTGGCGG
UTR dot + 25 .(.(((…))))(((((….((((.((.((((.((((.(.((((……….)))).).))))..))))..))..)))))))))
RS 1 seq GACCUUGGGAGGCGUUGAUCCGAUGGCGGCACGCACGCGGCCACCACGCACCGGCGGUGAGCCACUGGUGAGACCGGCCCGCGAGGCC
RS 1 dot ..(((((.(.((((((…(((.((((.((.(((.((..((……))..)))))))..)))).)))…)))..)))).)))))..
RS 2 seq CCGUUCUCAUUGGGGUGCGUUUUGCUGAGAAAUACCCAUAGAACCUGAUCUGAGUAAUAUCAGCGUAGGGAUUUGAGACUGCCUUUCAG
RS 2 dot .(((.(((….))).)))…..((((((..((..(.((((.((((..((((……))))..))))..)))).)..))..))))))
RS 3 seq CUGCACGGCACGGGAGACUCUGUCGCAGGACAGGGCCGAAGGAGCAACCGCCCCGGUAAACUCUCAGGCGAACGGACCUGGCGUGCGA
RS 3 dot .(((((.((.((((….((((((((..((.((.((((..((.((….))))))))…)).))..)))).))))))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table