Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069191 Similarity: 0.960 Similarity: 0.960 Similarity: 0.959
UTR: 5HSAA069191
Gene: MYL12A
MFE: -32.817
ENS: 0.737
Length: 147.
Predicted Ligands:
FMN - 13/20
cobalamin - 3/20
glycine - 2/20
 RS: URS0000C6BCE2_520764
MFE: -48.548
Ligand: FMN
Species: Fervidicola ferrireducens FMN riboswitch (RFN element)
 RS: URS0000C08690_1234679
MFE: -24.781
Ligand: cobalamin
Species: Carnobacterium maltaromaticum LMA28 AdoCbl riboswitch
 RS: URS0000D911BE_1895813
MFE: -55.444
Ligand: FMN
Species: Rhizobiales bacterium 63-7 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069191 URS0000C6BCE2_520764 URS0000C08690_1234679 URS0000D911BE_1895813
Length 147. 147. 148. 146.
Similarity - 0.960 0.960 0.959
Ensemble Norm 0.737 - - -
MFE -32.817 -48.548 -24.781 -55.444
Ligands - FMN cobalamin FMN
Gene MYL12A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.010 6.019 10.015
Length SE - 0. 1. 1.
Lev Distance - 47. 50. 49.
UBS 11. 10. 12. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 2.
ILR 4. 3. 4. 2.
H 3. 3. 3. 4.
BL 5. 2. 3. 3.
BR 4. 4. 4. 3.
UN 0.218 0.116 0.081 0.096

Sequences

Field Description
UTR seq + 25 ccgcccuucgccgugcccuggaaugugcggccaggcaaagccacaggacggacgcaaccaucugcggaaaggauaggggggaggaagacuuaacacugcaacaacaggacuuaaccaccaccATGGACTTAACCACCACCATGTCGA
UTR dot + 25 ((.((((((.((((….(((..(((.((.((.(((…)))…)).)).)))…)))…))))….)).)))).))…………..(((……)))…………..(((((…………)))))….
RS 1 seq GAAAGUCUUCGGGGCAAGGUGAGAAGGCAUUUUGCCUUCAAUUCCUGACCGGCGGUGAUAGGCGAAAAGCCUUAAGCCCGCGAGCCGAAAGGCUGAUCCGGUGAGAUUCCGGAGCCGACAGUAAAGUCUGGAUGGGAGAAGACUUGU
RS 1 dot …(((((((((.((..(((…(((((.(((((((((((…((…..))…))).)))))))).)))))..))).))…))))).))))..(((((…….)))))……….((((((……….))))))..
RS 2 seq GCUUGUUCAUGCUAUUUUAGAAAAAUGGAAGUUUGGUGAAAAUCCAACGCGGUCCCGCCACUGUAAUAAGCAAUGAUUGCUUUAAGUCAGGUCUUUUCUUCUAAGAUACUCUGGUACUAUUGUUUCGAGGCAAAACAAUAGGCUUUUG
RS 2 dot ((..(((..(((((((.(((……(((.((((((…….)))).))..)))…..))).)))).)))..))).))…….((((((((…….)))))…)))((.(((((((((…….)))))))))))…..
RS 3 seq CCUCGUUCUCAGGGCGGGGUGAAACUCCCCACCGGCGGUAUCGGGGAAACCCCGGAGCCCGCGAGCGCUUCCCGUCAAACGGAAGGUCAGCAGAUCCGGUGCGAUGCCGGAGCCGACGGUUAGAGUCCGGAUGAAAGAGGGCAGGC
RS 3 dot …(((((.(.(((((((((…..((((((((…)))…))))).)))))…))))).)))))(((((……..)))))(((.((…((((((…..)))))))).)))…….((((……….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table