Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069208 Similarity: 0.975 Similarity: 0.975 Similarity: 0.973
UTR: 5HSAA069208
Gene: MYL12B
MFE: -22.440
ENS: 0.956
Length: 106.
Predicted Ligands:
TPP - 10/20
glycine - 7/20
GMP - 1/20
 RS: URS0000D96F10_1121409
MFE: -32.262
Ligand: TPP
Species: Desulfofustis glycolicus DSM 9705 TPP riboswitch (THI element)
 RS: URS0000C25A5E_1179778
MFE: -29.841
Ligand: TPP
Species: Pseudomonas sp. M47T1 TPP riboswitch (THI element)
 RS: URS0000C726D8_1703399
MFE: -29.950
Ligand: TPP
Species: Deltaproteobacteria bacterium SM23_61 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069208 URS0000D96F10_1121409 URS0000C25A5E_1179778 URS0000C726D8_1703399
Length 106. 106. 106. 106.
Similarity - 0.975 0.975 0.973
Ensemble Norm 0.956 - - -
MFE -22.440 -32.262 -29.841 -29.950
Ligands - TPP TPP TPP
Gene MYL12B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 6.001 11.
Length SE - 0. 0. 0.
Lev Distance - 32. 32. 32.
UBS 8. 8. 9. 6.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 1.
ILR 4. 3. 2. 4.
H 2. 3. 3. 1.
BL 3. 3. 3. 2.
BR 0. 1. 0. 1.
UN 0.094 0.123 0.066 0.104

Sequences

Field Description
UTR seq + 25 aggguggaggagccuccuguugcacggucuugccuaaggugaagccuccaaggaagccauuagcauaauuaaacaaccaccATGTCGAGCAAAAAGGCAAAGACCA
UTR dot + 25 ..(((((..(…….(((((…((.(((.(((.((((…))))…))))))))..)))))……..)..))))).((((………))))…….
RS 1 seq ACGGUGGCCGAGGGGAGUCUUCCGACUGAGAAUCUCACCUACGUGAGAUGACCCUUUGAACCUGAUCCGGUUAAUACCGGCGGAGGGAACGGACCGAGAACCUGUA
RS 1 dot .(((.(..(((((((.(((((.((..((((…))))….)).)))))..)))))))..))))..(((((….)))))(((……….)))……….
RS 2 seq GGGUUCUUGUCGGGGUGCCUUGAGUGAAAGGCUGAGAUCGGUUAAUCCGGAUCCCGUUGAACCUGAUCAGGUUAGCGCCUGCGUAGGGAACAAGAUUUCUCGUCCU
RS 2 dot ((((((….((((((.((….(.((..(((((….)))))..)))))))))))..))))))…(((((….)))))((.(((((……)))))))….
RS 3 seq CAGAUUUGCUGGGGGAGCUGGACCGGCUGAGAGAUUUCGCCAAAGGCGGGAUGACCCCUCGAACCUGUUGGAUAAUGCCAGCGGAGGAAAGCAAAUCGAAAAGAGU
RS 3 dot ..((((((((……(((((.(((((((((.(((((((((…))))))))…).))))…..)))))……)))))…….))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table