Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069346 Similarity: 0.947 Similarity: 0.945 Similarity: 0.945
UTR: 5HSAA069346
Gene: MYO18A
MFE: -69.827
ENS: 0.873
Length: 183.
Predicted Ligands:
lysine - 12/20
cobalamin - 5/20
Mn2+ - 2/20
 RS: URS0000DAA2A3_1200302
MFE: -50.110
Ligand: Mn2+
Species: Photobacterium damselae subsp. piscicida DI21 yybP-ykoY manganese riboswitch
 RS: URS0000AB4497_342451
MFE: -39.074
Ligand: Mn2+
Species: Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 yybP-ykoY manganese riboswitch
 RS: URS0002315EB1_1337886
MFE: -58.693
Ligand: cobalamin
Species: Sporomusa sphaeroides DSM 2875 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069346 URS0000DAA2A3_1200302 URS0000AB4497_342451 URS0002315EB1_1337886
Length 183. 182. 182. 183.
Similarity - 0.947 0.945 0.945
Ensemble Norm 0.873 - - -
MFE -69.827 -50.110 -39.074 -58.693
Ligands - Mn2+ Mn2+ cobalamin
Gene MYO18A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.016 26.025 47.007
Length SE - 1. 1. 0.
Lev Distance - 65. 62. 55.
UBS 9. 11. 12. 13.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 1. 2. 1. 4.
H 4. 5. 4. 3.
BL 2. 2. 2. 4.
BR 1. 3. 5. 5.
UN 0.268 0.143 0.110 0.186

Sequences

Field Description
UTR seq + 25 uccaucccugaccgggccgaggcugcuggaugccgcgucuccgcuucugcugccugccgggcgggcuccgguggccgcagcaaaguggggcaccaaggcccugugcuaagcacucauaauccucugggggugcuaccccuacaaacagcacccccaccATGTTTAACCTAATGAAGAAAGACA
UTR dot + 25 …..(((…..)))….((((..(((.((((……((((((.((((((((((((((…..))))))))..))))))))))))))))))).))))..((((…))))………..((((((((((…………))))))))))………………………
RS 1 seq CCUUUGGGGAGUAGCCUCUAAUCUAGUGUUGCAAUAAGACUAGAGUAGACAUUCAUCAACAUAAUUGAAGCAAAAUCUUCAUGGUGAAUGUGACUGUUUUGGGUUUGGCAAGACCAUAGGUAAGACCGCAUAAACCGGGGUGGGGAGUGCGAGUUUUACUAUUGGUUCUAAUAAUAAUUCUC
RS 1 dot …..(((……)))(((.((((((.(((…))).)))))).)))((((((((((…….(((((……)))))))))))))))((((……))))……(((((..(((((((((((((…((……))..))))).))))))))..)))))……………
RS 2 seq UCAGUUGUCAGAGGGGAGUAACUUAACUUUAGUUGAAAAUAUAUGAGUUUCGCAUACAAUCGUUUAUAUAUGGUAAGUAAUGCAACUUAUUUAUCUUUUAACUUAGUCAUUUUAUCGUCAUUACGAAGUAUCAAACUUCCGGUAAAGUGGGCAGAAUAAAACUGUCGAGUGAGACCUUUGCU
RS 2 dot ..(((((((……)).)))))..(((..(((((((((((.(((((((..((((((.(((((……)))))..))).)))))))))).))).)))))))).)))((((((((((…….(((((…..)))))))))))))))(((((…….)))))…………….
RS 3 seq AUGAAUAUCGUUGGGAUAGGUGCCCUACGGGGCUUAAUAGGGAAGUCCGGUGCAAUGCCGGCGCGGUCCCGCCACUGUAACGGGGAGCAAUCUCGCAGAUAUGCCACUGGAGCGAACGCUUUGGGAAGGUGCGAGAAAGCAAUGAACCGGAGCCAGGAGAACUGCCUGUCUGACAAUCACCGU
RS 3 dot ….(((((..((((((.(.(.(((((((((((……((((.(((((((…..))))).))..))))))).)))))..))).).).))))))..)))))……………(((((((…..(((……)))…..)))))))((((…….))))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table