Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069429 Similarity: 0.979 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA069429
Gene: MYO9A
MFE: -12.976
ENS: 0.846
Length: 96.
Predicted Ligands:
glycine - 8/20
SAM - 6/20
TPP - 3/20
 RS: URS0000C7AB7D_1284708
MFE: -18.573
Ligand: glycine
Species: Tissierellia bacterium S7-1-4 Glycine riboswitch
 RS: URS0000AB7B27_458233
MFE: -22.115
Ligand: SAM
Species: Macrococcus caseolyticus JCSC5402 SAM riboswitch (S box leader)
 RS: URS0000AB9BCB_556261
MFE: -23.427
Ligand: glycine
Species: Clostridium sp. D5 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069429 URS0000C7AB7D_1284708 URS0000AB7B27_458233 URS0000AB9BCB_556261
Length 96. 95. 96. 95.
Similarity - 0.979 0.979 0.978
Ensemble Norm 0.846 - - -
MFE -12.976 -18.573 -22.115 -23.427
Ligands - glycine SAM glycine
Gene MYO9A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.023 3.009 8.027
Length SE - 1. 0. 1.
Lev Distance - 26. 28. 26.
UBS 4. 4. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 0. 0. 0. 1.
H 3. 3. 4. 4.
BL 1. 0. 1. 1.
BR 1. 0. 0. 0.
UN 0.458 0.305 0.365 0.295

Sequences

Field Description
UTR seq + 25 uuauuuuaccaagaaaaugguuugcacgacuuugaacauauacuauccaugcugaugggacaggauccaauATGAATATAAATGATGGAGGAAGAC
UTR dot + 25 …….((((……))))……………………(((((….)))))……((((.(((……..))).))))…….
RS 1 seq UGAUUUUAAACGGGAGAGACCGCUACAUGUAGUGGCGCCGAAGGUAUAAUAAGUAAAACUUAGAAGGACUCAGGCAAAAGGACCGUUUGAGGGAC
RS 1 dot ……….(((…….((((((…..)))))))))………(((((…)))))……(((((((………)))))))….
RS 2 seq UGCUUAUCCAGAGUGGUGGAGGGACUGGCCCUAUGAAACCCGGCAACCUAUUAAUUUAGGUGCUAAUUCCAGCAGGUAUAUCCUGAAAGAUAAGGU
RS 2 dot …….(((……)))((((…..))))………(((.(((((……))))))))……..((((…..))))………..
RS 3 seq CACUAAAACUCAGGAGAGUCUCUUGAUUUAAGAGCGCCGAAGGUGUAAGCAGCAAUAGCUGUAAAUCUCUCAGGCAAAAGGAUGGAGGAGUAAUU
RS 3 dot ………(((((((…)))))))…….(((((…)))))..(((((….)))))…((((.((..(….)..))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table