Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069822 Similarity: 0.991 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA069822
Gene: NAGPA
MFE: -17.338
ENS: 0.867
Length: 46.
Predicted Ligands:
preQ_1 - 11/20
glutamine - 4/20
SAM - 3/20
 RS: URS0000D65FCB_12908
MFE: -7.475
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E6043B_1797848
MFE: -24.
Ligand: unknown
Species: Deltaproteobacteria bacterium RBG_16_71_12 nhaA-I RNA
 RS: URS0000D673BE_12908
MFE: -10.597
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069822 URS0000D65FCB_12908 URS0000E6043B_1797848 URS0000D673BE_12908
Length 46. 46. 46. 47.
Similarity - 0.991 0.990 0.988
Ensemble Norm 0.867 - - -
MFE -17.338 -7.475 -24. -10.597
Ligands - glutamine unknown glutamine
Gene NAGPA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.002 4.017 6.008
Length SE - 0. 0. 1.
Lev Distance - 12. 12. 13.
UBS 4. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 0. 0. 1. 1.
H 1. 1. 1. 1.
BL 1. 1. 2. 1.
BR 3. 2. 2. 1.
UN 0.130 0.087 0. 0.043

Sequences

Field Description
UTR seq + 25 gacccgaggccccgguccaauATGGCGACCTCCACGGGTCGCTGGC
UTR dot + 25 ((((((.((….(((((……).)))).)).))))))……
RS 1 seq AUCGUUCAUCCCAAUGGGACGCAAGUAAGCCGACUCGGAACGGAUU
RS 1 dot .((((((…….((((.(((……)).).))))))))))…
RS 2 seq GGGUGCGGCGCAGGCUGCAGGACAGCGGGUGGUCGGGCCGCCACCC
RS 2 dot (((((((((.(.((((((..(….)..))))))).))))).))))
RS 3 seq UUCGUUCAUCCCCUUGGGGACGCAAAUGCCGACUGAAGGAACGGAUA
RS 3 dot ((((((…..((((.((…((….))…)).))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table