Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069823 Similarity: 0.991 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA069823
Gene: NAGPA_0
MFE: -19.359
ENS: 0.705
Length: 52.
Predicted Ligands:
unknown - 12/20
glutamine - 6/20
fluoride - 2/20
 RS: URS0000D689A5_349967
MFE: -13.316
Ligand: fluoride
Species: Yersinia mollaretii ATCC 43969 Fluoride riboswitch
 RS: URS0000E60585_1736316
MFE: -19.979
Ligand: unknown
Species: Pseudorhodoferax sp. Leaf267 nhaA-I RNA
 RS: URS0000E6093A_1888892
MFE: -21.442
Ligand: unknown
Species: Sphingomonas sp. MCT13 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069823 URS0000D689A5_349967 URS0000E60585_1736316 URS0000E6093A_1888892
Length 52. 52. 53. 52.
Similarity - 0.991 0.990 0.988
Ensemble Norm 0.705 - - -
MFE -19.359 -13.316 -19.979 -21.442
Ligands - fluoride unknown unknown
Gene NAGPA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.018 3. 4.006
Length SE - 0. 1. 0.
Lev Distance - 12. 11. 15.
UBS 5. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 0. 0. 0. 0.
H 1. 1. 1. 1.
BL 1. 1. 2. 2.
BR 4. 3. 4. 3.
UN 0.019 0.154 0.038 0.096

Sequences

Field Description
UTR seq + 25 ccacaugacccgaggccccgguccaauATGGCGACCTCCACGGGTCGCTGGC
UTR dot + 25 (((..(((((((.((….(((((……).)))).)).))))))).))).
RS 1 seq UUAAAUGCUGGAGAUGACAUCGCCCAUCAAGGCUGAUGAUGUCUACGUAACC
RS 1 dot …..(((((((.((..(((((((……))).)))))).)))).)))…
RS 2 seq GGGUGGCGUGCCAUGUCGGCGGGUCAGGUUCAUGCGAAGGUCGGGCCGCCUCG
RS 2 dot (((((((.((((…((.(((((……)).))))).)).)).)))))))..
RS 3 seq GGGUGCCGAUCCGACAGGGCGGCAGGUGUCAGCGCUGGUCGGGCCGCCAGUG
RS 3 dot .((((..(.((((((((.(((((….))).)).))).))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table