Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069998 Similarity: 0.976 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA069998
Gene: NAP1L4
MFE: -30.912
ENS: 0.810
Length: 114.
Predicted Ligands:
TPP - 17/20
homocysteine - 2/20
cobalamin - 1/20
 RS: URS0000C820E3_381
MFE: -37.973
Ligand: TPP
Species: Mesorhizobium loti TPP riboswitch (THI element)
 RS: URS0000BE1D4C_1287252
MFE: -41.337
Ligand: TPP
Species: Mesorhizobium sp. LNHC252B00 TPP riboswitch (THI element)
 RS: URS0000AB57F5_763057
MFE: -43.537
Ligand: TPP
Species: Mesorhizobium huakuii 7653R TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069998 URS0000C820E3_381 URS0000BE1D4C_1287252 URS0000AB57F5_763057
Length 114. 115. 115. 115.
Similarity - 0.976 0.976 0.976
Ensemble Norm 0.810 - - -
MFE -30.912 -37.973 -41.337 -43.537
Ligands - TPP TPP TPP
Gene NAP1L4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 1.001 1.001
Length SE - 1. 1. 1.
Lev Distance - 29. 31. 31.
UBS 10. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 4. 3. 4. 4.
BR 5. 4. 5. 5.
UN 0.088 0.104 0.052 0.052

Sequences

Field Description
UTR seq + 25 aaagcgagcgaagcuagggucgccgccacugccgcaggaggcgugaggugcggagacacgggugcugggccggggauaaaaacauucagATGGCAGATCACAGTTTTTCAGATG
UTR dot + 25 …((((.(……..).))))((((.(((((……)))).).))))..((((.((..(((….((((.((((……))))…))))….))).)).))))…..
RS 1 seq AACGCUCUAACGGGGUGCCGGACGCUGACUUCGCGAACCGGCUGAGAGGCGACAAUGCCAACCCGCUGAACCUGAUCCGGUUUGUACCGGCGGAGGGAUUAGACGUUUCGGACCA
RS 1 dot ..((((((…))))))((((.(((…….)))..))))….((((((.((((.((…((((((((((……))))…..)))))).)).))).).))))))……
RS 2 seq AACGCUCUAACGGGGUGCCGGACGCGAUCUUCGCGGACUGGCUGAGAGGCAGUCUCGCCAACCCGCUGAACCUGAUCCGGUUUGUACCGGCGGAGGGAUUAGACGUUUCGGACAG
RS 2 dot ..((((((…))))))((((.(((((…)))))..))))((((((.((((((((.((…(((.((((((……))))))…))).)).)))))).).).))))))….
RS 3 seq AACGCUCUAACGGGGUGCCGGACGCGAUCUUCGCGGACCGGCUGAGAGGCAGUCUCGCCAACCCGCUGAACCUGAUCCGGUUUGUACCGGCGGAGGGAUUAGACGUUUCGGACAG
RS 3 dot ..((((((…))))))((((.(((((…)))))..))))((((((.((((((((.((…(((.((((((……))))))…))).)).)))))).).).))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table