Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA069999 Similarity: 0.977 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA069999
Gene: NAP1L4_0
MFE: -23.843
ENS: 0.949
Length: 102.
Predicted Ligands:
purine - 10/20
TPP - 5/20
Ni/Co - 3/20
 RS: URS0000DA48D6_1313296
MFE: -22.127
Ligand: purine
Species: Paenibacillus uliginis N3/975 Purine riboswitch
 RS: URS0000C73AEC_509191
MFE: -23.858
Ligand: Ni/Co
Species: Acetivibrio cellulolyticus CD2 NiCo riboswitch
 RS: URS00007F4722_449
MFE: -29.470
Ligand: TPP
Species: Legionella hackeliae TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA069999 URS0000DA48D6_1313296 URS0000C73AEC_509191 URS00007F4722_449
Length 102. 102. 102. 100.
Similarity - 0.977 0.977 0.977
Ensemble Norm 0.949 - - -
MFE -23.843 -22.127 -23.858 -29.470
Ligands - purine Ni/Co TPP
Gene NAP1L4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 7.002 5.016
Length SE - 0. 0. 4.
Lev Distance - 30. 29. 25.
UBS 7. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 2. 1. 3.
H 3. 2. 4. 2.
BL 2. 2. 0. 1.
BR 1. 1. 1. 2.
UN 0.186 0.255 0.137 0.060

Sequences

Field Description
UTR seq + 25 aagcgagcgaagcuagggucgccgccacugccgcaggaggcgugaggugcggagacacgggggauaaaaacauucagATGGCAGATCACAGTTTTTCAGATG
UTR dot + 25 .(((…….)))…(((.(((((((.(((……))))))….)))).)))………((((((…..(((…..)))…))))))……
RS 1 seq UUCAGUAAAUUAAAUAUUUCUCGUAUAAAGCUGGGGAUAUGGCCCGGAAGUUUCUACCCGAAAACCGUAAAUUUUCGGACUACGAGGGAAUACGGCGGUGCU
RS 1 dot ………………….(((.(((.(((((…….)))))…))).)))(((….(((((..((((((…..))))))..))))))))….
RS 2 seq ACAGUACAAACUGAUCAGGCGAUAAACCCCAAAUUUUAAGGUUUAUGCAGCUGGGCCAUAAACGGCAGCAGAUGAAAAAUAUAACACAUCUGUGGGACAGUG
RS 2 dot .((((….))))..(((..((((((((………..))))))).)..))).(((……))).(((((((…………)))))))………
RS 3 seq UGCCUUCACCGGGGGUGCUUUGCAGUGAUGCAAGGCUGAGAAAAACCCUUAUAACCUGCUCUGGUUAAAACCUGCGGAGGGAGUGUGAGACCAGACUAUU
RS 3 dot .((…….((((((((((((((….))))))))……..))))))…….))(((((((…((((.(….).)).))..)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table