Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070299 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA070299
Gene: NAT9
MFE: -43.082
ENS: 0.925
Length: 99.
Predicted Ligands:
TPP - 10/20
purine - 3/20
SAM - 2/20
 RS: URS0000C19477_1111454
MFE: -27.677
Ligand: SAM
Species: Megasphaera sp. BV3C16-1 SAM riboswitch (S box leader)
 RS: URS0000AB5248_287752
MFE: -42.790
Ligand: TPP
Species: Aurantimonas manganoxydans SI85-9A1 TPP riboswitch (THI element)
 RS: URS0000C34AF4_883158
MFE: -24.363
Ligand: TPP
Species: Prevotella micans F0438 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070299 URS0000C19477_1111454 URS0000AB5248_287752 URS0000C34AF4_883158
Length 99. 99. 97. 100.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.925 - - -
MFE -43.082 -27.677 -42.790 -24.363
Ligands - SAM TPP TPP
Gene NAT9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.001 11.001 5.001
Length SE - 0. 4. 1.
Lev Distance - 20. 19. 26.
UBS 7. 9. 7. 8.
BS 0. 0. 0. 1.
ILL 0. 1. 1. 1.
ILR 0. 2. 1. 0.
H 2. 2. 2. 2.
BL 5. 3. 2. 4.
BR 3. 5. 3. 4.
UN 0.141 0.172 0.103 0.110

Sequences

Field Description
UTR seq + 25 gggaacguggcugguuggaggagguagaucacccuuucugcgggggacgauuucgucggugguaggcugcuaccATGCAGGCTGCTACCATGAGGTTGA
UTR dot + 25 ……….((.((.(((((.(((…..)))))))).)).))…(((((((((.((((((((.((((……)))).))))))))))))))))).
RS 1 seq UUUUCAUCAAGAGCAGCAGAGGGACUGGCCCUGUGAAGCUGCGGCAACCUCCUUUCGGGGAAAGGUGCUAAUUCCAGCGGUUUUACCGACAGAUGAAGG
RS 1 dot …………((((((.((((…..)))).)…)))))…..((((((.((((..((((.((((……)))).)))).)))).))..)).))
RS 2 seq CGUGCUCACACGGGGUGCCUUCGGGCUGAGAGGCGCAUGCCGACCCGUCGAACCUGAUCCGGCUCAUACCGGCGGAGGGAUGCGGGCGUCGGCGGGU
RS 2 dot ……….(((.((((((((…….)))).)))).)))(((((((((.((((((((..(((………))))))).))))..)))))))))
RS 3 seq GUGGAAGCUAAGGGGUGCUCGCUCGUUUGGGCGGUGCUGAGAAUAUACCCGAGAACCUGAUGCGGAUAAUACCGACGUAGGGAUUUUUACUCUCCCCUUU
RS 3 dot ………(((((((((.(((((….))))))))).((((.((…..((((.(((.((((((……))).))).))).)))))).))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table