Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070300 Similarity: 0.972 Similarity: 0.968 Similarity: 0.965
UTR: 5HSAA070300
Gene: NAT9_0
MFE: -56.726
ENS: 0.862
Length: 127.
Predicted Ligands:
cobalamin - 7/20
SAM - 7/20
TPP - 2/20
 RS: URS0000AB9723_12908
MFE: -29.354
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS000232EFCB_1284664
MFE: -65.188
Ligand: cobalamin
Species: Streptomyces gancidicus BKS 13-15 Cobalamin riboswitch
 RS: URS0000AB763F_12908
MFE: -25.574
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070300 URS0000AB9723_12908 URS000232EFCB_1284664 URS0000AB763F_12908
Length 127. 126. 127. 128.
Similarity - 0.972 0.968 0.965
Ensemble Norm 0.862 - - -
MFE -56.726 -29.354 -65.188 -25.574
Ligands - cobalamin cobalamin cobalamin
Gene NAT9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 12. 19.009
Length SE - 1. 0. 1.
Lev Distance - 33. 39. 39.
UBS 7. 8. 10. 7.
BS 0. 0. 0. 2.
ILL 0. 1. 1. 2.
ILR 1. 2. 1. 1.
H 2. 2. 2. 3.
BL 4. 2. 5. 1.
BR 3. 2. 4. 4.
UN 0.071 0.103 0.063 0.164

Sequences

Field Description
UTR seq + 25 gcaugcggaaggggcgguagccggccgggccugggaacguggcugguuggaggagguagaucacccuuucugcgggggacgauuucgucgguggcugcuaccATGCAGGCTGCTACCATGAGGTTGA
UTR dot + 25 …(((((((((((.((((((((((((.(……..).)))))))))………..))).)))))))))))…..(((((((((.((((((.(((……..))).))))))))))))))).
RS 1 seq UAAAUAAGUUUAUAUGUGAUGAAGUAGAGUGAAAUUCUCUCACUGUCGCGCAACGGUUAAAGUCCGAACUCACGUAUAAGCUAAAGACGUAGCUAGGCUCGCGGAAAGCUAAGCAGUUACUCAAAA
RS 1 dot ……(((((((((((((((((((((((…….)))).))).)))…………………)))))))))))))…((.((((((..(((.((…..))..)))))))))))….
RS 2 seq GGGCGGGUACAGUGGCCGGGUCGUAUCACAGUCGUACGGGGGGAAGCCGGUGCGAAUCCGGCGCUGACCCGCAACCGUGAGCCGUCGGGGAGACGGUGAGCCGGACUGCCCCGUACGGAUCGUGACC
RS 2 dot ..((((((.((((.(((((((……….((((((.((……)).)))))))))))))))))))))))…(((((.(((((((((((.(((….)))..)).))))).)))).)))))…
RS 3 seq ACUUUGAAUUUGGUGGGGAAUUAAUGUGAAAUUCAUUAGCUGUUCCUGCAACGGUAAAGUCCGAGCGCCACCCAGAGUAGCCCGCUGUUGAAUGAAGGCCAGGAAAAGUCUAGUUCUACAAUUUAAAU
RS 3 dot ((((((…..(((((((((((((((…….)))))…))))).((..(((……))).)).)))))))))))…….(((.((((..((((……..)))).)))).)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table