Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070334 Similarity: 0.966 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA070334
Gene: NBN
MFE: -50.645
ENS: 0.980
Length: 135.
Predicted Ligands:
FMN - 10/20
cobalamin - 4/20
molybdenum - 2/20
 RS: URS0000D87366_1797348
MFE: -36.265
Ligand: FMN
Species: Bacteroidetes bacterium GWF2_41_31 FMN riboswitch (RFN element)
 RS: URS00023310CE_1434701
MFE: -19.747
Ligand: cobalamin
Species: Chishuiella changwenlii Cobalamin riboswitch
 RS: URS0000C758D7_768710
MFE: -30.803
Ligand: molybdenum
Species: Desulfosporosinus youngiae DSM 17734 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070334 URS0000D87366_1797348 URS00023310CE_1434701 URS0000C758D7_768710
Length 135. 134. 135. 135.
Similarity - 0.966 0.965 0.965
Ensemble Norm 0.980 - - -
MFE -50.645 -36.265 -19.747 -30.803
Ligands - FMN cobalamin molybdenum
Gene NBN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.010 3.001 3.002
Length SE - 1. 0. 0.
Lev Distance - 43. 46. 46.
UBS 8. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 1. 2. 2. 1.
H 4. 5. 4. 4.
BL 2. 2. 3. 1.
BR 2. 1. 2. 3.
UN 0.148 0.246 0.119 0.193

Sequences

Field Description
UTR seq + 25 gagcgcgcacgucccggagcccaugccgaccgcaggcgccguauccgcgcucgucuagcagccccgguuacgcgguugcacgucggccccagcccugaggagccggaccgATGCAGAATGGCTTTTCCCGAACTT
UTR dot + 25 (((((((…….(((.(((..(((…..)))))).)))….)))))))…..((((((.((….)).))))))…..(((….)))..(((((((((………….)))))))))……..
RS 1 seq CAAUUGAUUCAGGGCAGGGUGAAAUUCCCGACCGGCGGUGACAGUCCGCGACUCCCGUUCCGAAAAUUUUAGGAUGGGACUGAUCUGGUGAAACUCCAGGGCCGACAGUAAAGUCUGGAUGGUAGAAGCGAUUG
RS 1 dot …………((..(((…….)))..)).((((…….))))…((((((((.(((…))).))))))))…..((((…….)))).((((.(((……)))..))))………..
RS 2 seq GUUUUGAGUUAUUAACUUUGUAUAGAAUUUAUGAGUUAAAAAAUUGGAGAAUCGUGUGAGAAUCACGAACUGUCGCGCAACUGUAAGUAAUGAUGAAUUACAAGUCAGAUUACCAAUAAAAACAUAAGAUGAUAC
RS 2 dot .((((.((((.(((((((…………..)))))))..)))).))))…((((((.(………).))))))……..(((((…..)))))..((((..(((…………)))..))))..
RS 3 seq AUUAAAUAUUGAAUCCGAGCUUUUUAUUCUAAAGGAAGCUUCCCAUGAAUACUAAGCCUAAACCGGAGGGUUUACGGGGUUAGACAGGAAACAGUCUGGCCUUCACUUGUGAGAAGGAUGAUGCUUAAAAACAGA
RS 3 dot ……((((.(….(((((((((…….)))))))))….).))))…..((((((((….)))))).))((((((((……..)))))))).((((((……))).)))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table