Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070410 Similarity: 0.956 Similarity: 0.954 Similarity: 0.952
UTR: 5HSAA070410
Gene: NCAPG2
MFE: -58.240
ENS: 0.919
Length: 170.
Predicted Ligands:
lysine - 12/20
TPP - 7/20
Mg2+ - 1/20
 RS: URS0000AB5806_559882
MFE: -48.017
Ligand: TPP
Species: Trichophyton equinum CBS 127.97 TPP riboswitch (THI element)
 RS: URS0000C570E0_1081103
MFE: -63.062
Ligand: TPP
Species: Metarhizium album ARSEF 1941 TPP riboswitch (THI element)
 RS: URS0000D78BD5_1797683
MFE: -37.798
Ligand: lysine
Species: Clostridiales bacterium GWF2_38_85 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070410 URS0000AB5806_559882 URS0000C570E0_1081103 URS0000D78BD5_1797683
Length 170. 170. 169. 170.
Similarity - 0.956 0.954 0.952
Ensemble Norm 0.919 - - -
MFE -58.240 -48.017 -63.062 -37.798
Ligands - TPP TPP lysine
Gene NCAPG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.003 14.002 10.004
Length SE - 0. 1. 0.
Lev Distance - 55. 54. 60.
UBS 12. 12. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 4. 1. 2.
ILR 3. 4. 0. 1.
H 4. 5. 5. 5.
BL 2. 0. 3. 4.
BR 3. 3. 4. 4.
UN 0.188 0.135 0.148 0.124

Sequences

Field Description
UTR seq + 25 gagagcggcgccugaugacgaccgggagggcggggcccgucuggggcgccggcgggugcguuugaaucugguccgagcgcgggaaacggcggguccccgagcccaggguuacaaaauaaaugccauuugaacagugccaucugucATGGAAAAACGTGAGACGTTTGTAC
UTR dot + 25 …..(((((.(….).)).)))…((((((((((((((….((((((((((((……..)))))..))).))))…….))))))))))…))))………………(((..((.((((……)))))))))..((((((…))))))….
RS 1 seq GUGUGCAUGAACCGGUGUUCGUUGUCCUUGAUCGUCCCGCAUCCAACUCUGCCUCCCCGUGCUAGGGAUGGUCCAGAGAGAUGCCAGAUGCAUUGAGGCUUCGUUCUGAAAUUAUACGGUCCGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCUUCCCCCUCCC
RS 1 dot ….((((((((….)))))).))(((((((((((..(((((…(((((((..(((……)))..))..))))).)))))..)))).))))))).((((..(((……..)))..))))……((((……))))…..(((…….)))…….
RS 2 seq GCUUGCAUGAGCCGGUGCCCGGUCCUCUGUUUCGCCCCUUUGAGGCUAUGUGCCGGGAGCAUUCUUGCUCCUUCUCAAACGAGGUCGAAUCAGGGGAUGGUGGCUGAGAUCAUACGGCCCUGAACUUGAUCUGGAUCAUACCAGCGAAAGGAUCAUGCUUGAUCCCCCA
RS 2 dot ….((((……))))((.((((((((.(((((((.(((((((………(((((((….)))))))))))))).).)).)))).)))))))))).(((((……..)))))………..((((……))))…..((((((….))))))….
RS 3 seq UUUUAUGGUAGAGGCGCAUCUUAUAAUAAAUAGUUGAUAUUUAAAUCUGUUUCACAGACAGGAAUCAACGAAAGGUAUGGAUGCCGAAGACAGCCAAGGUGAAAGGCUGAUCUGGUUUGAGUAAAUAAGAUUGCUCCGACUGUCGCAUUUUGCGGAGAGCUAUCUGAAAA
RS 3 dot ………….(.(((((.((((…….((((((.(((…(((((…))))).))).))))))……))))))))))..((((((((………))))).)))((((.((((((……)))))).)))).(((((…)))))(((….)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table