Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070418 Similarity: 0.954 Similarity: 0.953 Similarity: 0.950
UTR: 5HSAA070418
Gene: NCAPG2_0
MFE: -58.767
ENS: 0.982
Length: 172.
Predicted Ligands:
lysine - 15/20
TPP - 2/20
cobalamin - 2/20
 RS: URS0000D9454B_43305
MFE: -40.309
Ligand: lysine
Species: Clostridium proteoclasticum Lysine riboswitch
 RS: URS0000C53728_1423742
MFE: -40.648
Ligand: lysine
Species: Lactobacillus equigenerosi DSM 18793 = JCM 14505 Lysine riboswitch
 RS: URS0000D9D316_1667172
MFE: -40.557
Ligand: lysine
Species: Staphylococcus sp. NAM3COL9 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070418 URS0000D9454B_43305 URS0000C53728_1423742 URS0000D9D316_1667172
Length 172. 173. 173. 173.
Similarity - 0.954 0.953 0.950
Ensemble Norm 0.982 - - -
MFE -58.767 -40.309 -40.648 -40.557
Ligands - lysine lysine lysine
Gene NCAPG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3.007 8.
Length SE - 1. 1. 1.
Lev Distance - 58. 61. 62.
UBS 11. 11. 12. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 3. 3. 3. 3.
H 5. 4. 5. 4.
BL 1. 2. 1. 2.
BR 1. 3. 2. 0.
UN 0.169 0.185 0.087 0.162

Sequences

Field Description
UTR seq + 25 gcgagagcggcgccugaugacgaccgggagggcggggcccgucuggggcgccggcgggugcguuugaaucugguccgagcgcgggaaacggcggguccccgagcccaggguuacaaaauaaaugccauuugaacagugccaucugucATGGAAAAACGTGAGACGTTTGTAC
UTR dot + 25 ((….))….((((……..)))).((((((((((((((….((((((((((((……..)))))..))).))))…….))))))))))…))))………………(((..((.((((……)))))))))..((((((…))))))….
RS 1 seq GGUUUAGAUAGAGGUUGCGUAUUUAAUGAGUAUUUCUGUGGAUGUGACAGGCACAGAUGAAUCAGAAAAAAAGGUAAAUACGCCGAAAGGUUCAAUUACCUGAAGAUUGGAUACUUGGGCAUGCAGCAAACAGCUGUAUGACUGUCAUCGAAAGAUGGGGCGCUAUCAACAAU
RS 1 dot …………….(((((((((…….((((((((..((((…..))))..))…))))))……)))))))))….((((……))))…..((.(((((..((.((((((((…..)))))))).)))).))).)).(((((….)))))……
RS 2 seq UAGUUUUGAAGAGGUCGCAUGAAUCAUCAGUAUGAUUAGCUAGGUGGACAAACGCUGGAACUAAUCAGAAAGGGAAACGUGCCGAAACAACUUACUGUUUGUCCGGUAAGGAGUUGGGGGAUUGUUGAAGAAGCAAUUCACUGUCGUGGAAAUCACGGAGCGCUUCGUUAAAG
RS 2 dot ..((((((……..(((((..((.((….(((((((((((((……)).))))..)))))))….))))..)))))))))))..(((((((……)))))))……((((((((((…..)))))))).)).(((((…..)))))((((…))))….
RS 3 seq AUUUGAGUUAGAGGUUGCAUUUUCAAUGAGUAAUUAUUCAGAAGCCGAAUGGGGCAUAUGUUGAAUAAUAGAAAGGUGAAGAUGCCGAAACUUGUAUUGUCCAUUAAAUAUACAGGUUGGGCCAGUUAUCGAAAGAAACUGGACUGUCACAUACGUGAUGUGCUACCUAUAUA
RS 3 dot …………….(((((((((…….(((((((((..(((……)))…..)))))))))…….)))))))))(..(((((((((…………)))))))))..)((((((.((….))))))))((.(((((….)))))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table