Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070477 Similarity: 0.979 Similarity: 0.978 Similarity: 0.975
UTR: 5HSAA070477
Gene: NCAPH
MFE: -29.442
ENS: 0.961
Length: 109.
Predicted Ligands:
SAM - 17/20
TPP - 2/20
guanidine - 1/20
 RS: URS0000ABC53F_264732
MFE: -36.361
Ligand: SAM
Species: Moorella thermoacetica ATCC 39073 SAM riboswitch (S box leader)
 RS: URS0000C4285D_1293054
MFE: -24.979
Ligand: SAM
Species: Halanaerobium saccharolyticum subsp. saccharolyticum DSM 6643 SAM riboswitch (S box leader)
 RS: URS0000C6F1AF_1502724
MFE: -45.089
Ligand: guanidine
Species: Devosia sp. LC5 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070477 URS0000ABC53F_264732 URS0000C4285D_1293054 URS0000C6F1AF_1502724
Length 109. 109. 109. 109.
Similarity - 0.979 0.978 0.975
Ensemble Norm 0.961 - - -
MFE -29.442 -36.361 -24.979 -45.089
Ligands - SAM SAM guanidine
Gene NCAPH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 1.002 2.004
Length SE - 0. 0. 0.
Lev Distance - 27. 30. 33.
UBS 8. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 2.
ILR 1. 0. 1. 1.
H 3. 3. 3. 3.
BL 2. 3. 3. 2.
BR 2. 3. 2. 3.
UN 0.183 0.183 0.229 0.119

Sequences

Field Description
UTR seq + 25 gccggcgacgucacgcggccguuacggcgcucaggcgucucgacgcgcgcgauuuaaaaccagcucaggagacgccaaggaaagATGTCAGAGATTCTTAAACAGAAAG
UTR dot + 25 ((((..((((((….))).))).))))…..((((((((((.((…………….))))..))))))))…..((((.(((…)))))))……….
RS 1 seq CUCUUAUCGAGAGCUGGCGGAGGGACUGGCCCGAUGAAGCCCGGCAACCGGCCUCUUAGAACCCAGGUACGGUGCCAAUUCCUGCAGGAUUUCUCCUGGCAGAUGAGAG
RS 1 dot …((((((.(.((((((…..).))))))))))))…..(((.((((((((……….)))).)))))))…..((((((((….))))).)))…….
RS 2 seq AAAUCAUCAAGAGCGGUGGAGGGACUGGCCCUGUGAUACCCGGCAACCUACUUAAAAUCUUUAGUAAGGUGCUAAUUCCAGCAUUCCGGAAAGGAAUGAUAGAUGAGAG
RS 2 dot ..((((.((.(..((((……))))..).))))))….(((.(((((((……….)))).))))))……..((((((…..))))))………..
RS 3 seq CGAGUUGGGUGCUAGGGUUCCGGCGUCGUGGUGACGUGUCUGGUCCGAGAGCCACCCGCCGGCACGGGAGCAAUCGUGCCGGACACGGCGGGACAAAAGCCCGGGAGAC
RS 3 dot (((((((((………)))))).)))……((((((((((.(((..((..((((……)))).))..))).)))))))))).((((.(….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table