Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070478 Similarity: 0.975 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA070478
Gene: NCAPH_0
MFE: -31.538
ENS: 0.968
Length: 112.
Predicted Ligands:
SAM - 19/20
cobalamin - 1/20

 RS: URS0000C33961_1869312
MFE: -42.355
Ligand: SAM
Species: Desulfuromonadales bacterium C00003068 SAM riboswitch (S box leader)
 RS: URS0000C268DB_1590652
MFE: -42.787
Ligand: SAM
Species: Cohnella kolymensis SAM riboswitch (S box leader)
 RS: URS0000C4C09E_872965
MFE: -44.824
Ligand: SAM
Species: filamentous thermophilic bacterium 110S SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070478 URS0000C33961_1869312 URS0000C268DB_1590652 URS0000C4C09E_872965
Length 112. 111. 112. 111.
Similarity - 0.975 0.975 0.975
Ensemble Norm 0.968 - - -
MFE -31.538 -42.355 -42.787 -44.824
Ligands - SAM SAM SAM
Gene NCAPH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.003 1.001 5.005
Length SE - 1. 0. 1.
Lev Distance - 30. 33. 31.
UBS 9. 8. 9. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 3. 2. 2.
H 3. 3. 3. 3.
BL 2. 1. 3. 2.
BR 2. 1. 2. 2.
UN 0.116 0.171 0.143 0.189

Sequences

Field Description
UTR seq + 25 cccgccggcgacgucacgcggccguuacggcgcucaggcgucucgacgcgcgcgauuuaaaaccagcucaggagacgccaaggaaagATGTCAGAGATTCTTAAACAGAAAG
UTR dot + 25 ..(((((..((((((….))).))).)))))((..((((((((((.((…………….))))..))))))))..)).((((.(((…)))))))……….
RS 1 seq GUGGUGGAGGGAUUGGCCCUUUGAAACCACAGCAACCGAUCCCUGAGCCGUUUCCACGGUAUUGGGAUGCCAGGUGCUAAUUCCAACCCCCUUUUGGGGGAAAGAUGAGAC
RS 1 dot (((((((((((…..))))))…)))))(((.(((((((((…(((((….)))))…))))).)..))))))……..(((((….)))))………..
RS 2 seq UUCUUAUCAAGAGAGGCGGAGGGAUAACGGCCCUAUGAUGCCCGGCAACCGAUCCACGCAAGUGUGGAGUUCGGUGCCAAUUCCGCCGGACGCAAGGUCCGGAAGAUGAGAG
RS 2 dot ….(((((..((.(((.(……..).))))).)))))…(((.((((((((((……)))))..))))))))…((..((((((…..))))))..))……
RS 3 seq CUCUUAUCAAGAGGGGUGGAGGGACCGGCCCUGUGAAGCCCCGGCAACCAGCCUGCUCAGGCAGGCCAGGUGCCAAUGCCGGCAGAAGCGCUUGCUUCUGGACGAUGAGAG
RS 3 dot ……(((..((((.(((…..))).)))).)))….(((((((((.(((((……)))))..)))…..))))))(((((((….)))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table