Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070525 Similarity: 0.879 Similarity: 0.869 Similarity: 0.869
UTR: 5HSAA070525
Gene: NCDN
MFE: -77.686
ENS: 0.827
Length: 300.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
FMN - 1/20
 RS: URS00023195C5_468056
MFE: -58.944
Ligand: cobalamin
Species: Flavobacterium sp. H7 Cobalamin riboswitch
 RS: URS0002322B36_555779
MFE: -117.232
Ligand: cobalamin
Species: Desulfonatronospira thiodismutans ASO3-1 Cobalamin riboswitch
 RS: URS00023323C3_1317122
MFE: -66.133
Ligand: cobalamin
Species: Aquimarina atlantica Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070525 URS00023195C5_468056 URS0002322B36_555779 URS00023323C3_1317122
Length 300. 296. 298. 302.
Similarity - 0.879 0.869 0.869
Ensemble Norm 0.827 - - -
MFE -77.686 -58.944 -117.232 -66.133
Ligands - cobalamin cobalamin cobalamin
Gene NCDN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 36.004 48.001 56.002
Length SE - 16. 4. 4.
Lev Distance - 121. 145. 141.
UBS 14. 16. 17. 17.
BS 0. 0. 0. 0.
ILL 2. 5. 6. 5.
ILR 3. 4. 4. 6.
H 9. 7. 7. 5.
BL 1. 4. 4. 3.
BR 1. 4. 4. 4.
UN 0.133 0.199 0.111 0.172

Sequences

Field Description
UTR seq + 25 aucccagccggggccucuccgagccggcgcugaucgaugccgacacaccccggggacccuaucgcgacuccaucgcgccauaucgcgacaccaucgugcccugucgagacuccauuuugucacagcccuuuucaauauauaucuuuuuuuuuuuuaauuugcccugucaucuuugggggcugucucccaugucgugauuuugacgugaucucuccgugacaucaccgcgccaucgugaagugugaucucaucgccgcccugucgugacuucaucaATGGCCTCGGATTGCGAGCCAGCTC
UTR dot + 25 ……(((((((…))))).))(((((……..)))))……..(((((…….(((((…..(((((……)))))…..))))))))))….(((……..)))(((((((((……………………………………..)))))))))….(((((((……)))))))……..(((….)))…(((((.((((((((((((…)))))…………)))))))..)))))((((…..))))…….
RS 1 seq CAUUUGCAGCCGUAUUGAGGUUGCUGUUUUUAAUUUUAAAACCGCAUUAAAAGGGAAUCAGGUGAAAGAUUGCAGAUUGCAGAUUUUAGAUUGUAACAAUCAAAAAAAUCUAAAUCGAAAAUCCAGAAUCCUGGGCUGUACCCGCAACUGUAAGCUGUCAAGCUUGUUGUUAUCUACAAAACCACUGUUCAAAAUUUUAGAAUUGAGAUUUCAGAUUUUAUCAAAUCGGAAAUCAAGAAUGGGAAGGUAAACAACAAGACGCAAGCCAGGAGACCUGCCUAUUACAUCGAGUAUCA
RS 1 dot …..((((((…….)))))).(((((…….)))))………..(.((((……..)))).).((((..(((((((.(((((…)))))…))))))).))))………((((..(((..((((…(((((…(((((….))))))))))….))))…)))..))))…………….((((((.(((((….))))).))))))…((((((.((((……………………)))).))))))………….
RS 2 seq UUAAGGACAGUCGUCUCAGGUUUUCCCCAGUCAGGGGAAAUGAAAAGGGAAUCCCGUGUAAAUCGGGAACCGGCCCGCGGCUGUGAGCGGGGACGAAAGCCGCAUUAAGCCACUCUGGACAGAAACAGGGGAAGGCGCGGCAAGCCCAGCACUCACUUCAUUUCUGUUUGUUGCUUAUAAUCAGGUUGUACUGCAAGGAGCCAACCGGUUUAACUGGCAACAAUUAGUACCUGAAGUGAGUGCUGGGCAAGUAGGACGAUCCGCAAGUCAGAAGACCUGCCUGAGACCUUAUUGGACC
RS 2 dot ….((((….))))…..(((((((…..)))))))…….((..(((((…….))))).))..(((((……..)))))…….(((((…..(((.(((((……..)))))…))))))))..(((((((((((((((((…(((.((((((((…((((.(((((..((……)).)))))))))…..)))))))).)))….))))))))))))))))).((((((…….(((.(((….))).)))…….))))))…..
RS 3 seq ACAUUCGCGCAGAAUUUUGGUUCUGAUACUCCUUGAUCAAGGGAGUUGAAGAUUAAAAGGGAAUCAGGUACAAUGAAAAAUGAAGGUAGAGAUAUGAAUAGCGAUUUUUUAAUUUUUAAUCGUAUUUCUAACAUCUGGCAUCGUAAAUCAAUAUUCCUGAGCUGUUCCCGCAACUGUAUGCUGUGUCCACAUUAAAAAAGGAUGCUUGUUGUUAAUUCUUUAUAACCACUGCUCGUUAUGGCGAUCGGGAAGGUAAACAACAAGACGCGAGCCAGGAGACCUGCCAUUAUUCGAUAUAAUCA
RS 3 dot ………((((((….))))))..(((((((…..)))))))…………((((((((((…..(((…((((((((((((((((((.(((.((((….)))).))).))))))))))…))))….))))…)))…..)))))….)))))……….((((((((………………((((((((…(((((…….(((.((((….)))).))))))))..))))))))))))).)))((((…))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table