Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070624 Similarity: 0.972 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA070624
Gene: NCOA3
MFE: -40.585
ENS: 0.886
Length: 128.
Predicted Ligands:
TPP - 11/20
cobalamin - 6/20
SAM - 1/20
 RS: URS0000C677E9_3708
MFE: -54.163
Ligand: TPP
Species: Brassica napus (rape) TPP riboswitch (THI element)
 RS: URS0000C3D821_81985
MFE: -52.263
Ligand: TPP
Species: Capsella rubella TPP riboswitch (THI element)
 RS: URS0000C1ABB2_3708
MFE: -55.213
Ligand: TPP
Species: Brassica napus (rape) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070624 URS0000C677E9_3708 URS0000C3D821_81985 URS0000C1ABB2_3708
Length 128. 129. 128. 129.
Similarity - 0.972 0.972 0.971
Ensemble Norm 0.886 - - -
MFE -40.585 -54.163 -52.263 -55.213
Ligands - TPP TPP TPP
Gene NCOA3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3.001 4.001
Length SE - 1. 0. 1.
Lev Distance - 35. 37. 37.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 2. 1. 1. 1.
H 4. 4. 4. 4.
BL 2. 1. 1. 1.
BR 0. 1. 0. 1.
UN 0.273 0.302 0.305 0.302

Sequences

Field Description
UTR seq + 25 agucgguggcggccggcggcggcugcgggcugagcggcgaguuuccgauuuaaagcugagcugcgaggaaaauggcggcgggaguugcugauguauauucaagATGAGTGGATTAGGAGAAAACTTGG
UTR dot + 25 ..(((((.(((((((….)))))))..)))))(((((.(((((……..)))))..)))))………((((((….))))))……((((((…))))))………………
RS 1 seq GAAAAGCACCAGGGGUGCUUGAACCAGGCUAGCCUGCUAAAACGCGGGGUAGCCUGGGAACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUGCAGUUUUCUUUUU
RS 1 dot …(((((((…)))))))…((((((((.(((((……))))).))))))))…..((((…..))))……..((((..((((……))))..))))………………..
RS 2 seq AAAAAGCACCAGGGGUGCUUGAACCAGACUAGCCCGCGAAAGAGCGGGCUAUCUGGGACCAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUGCAUGUUUUUUUCU
RS 2 dot …(((((((…)))))))…(((((.((((((((……)))))))))))))…..((((…..))))……..((((..((((……))))..))))………………..
RS 3 seq GAAAAGCACCAGGGGUGCUUGAACCAGGCUAGCCUGCUAAAAAGCGGGGUAGCCUGGGAACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUGCAGUUUUCUUUUU
RS 3 dot …(((((((…)))))))…((((((((.((((((….)))))).))))))))…..((((…..))))……..((((..((((……))))..))))………………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table