Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070715 Similarity: 0.943 Similarity: 0.942 Similarity: 0.941
UTR: 5HSAA070715
Gene: NDC80
MFE: -62.478
ENS: 0.806
Length: 195.
Predicted Ligands:
cobalamin - 19/20
molybdenum - 1/20

RS: URS000233075C_36849
MFE: -52.123
Ligand: cobalamin
Species: Oxobacter pfennigii Cobalamin riboswitch
RS: URS00023273B1_1402860
MFE: -58.173
Ligand: cobalamin
Species: Bacillus enclensis Cobalamin riboswitch
RS: URS000232B42A_645991
MFE: -51.644
Ligand: cobalamin
Species: Syntrophobotulus glycolicus DSM 8271 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070715 URS000233075C_36849 URS00023273B1_1402860 URS000232B42A_645991
Length 195. 194. 196. 195.
Similarity - 0.943 0.942 0.941
Ensemble Norm 0.806 - - -
MFE -62.478 -52.123 -58.173 -51.644
Ligands - cobalamin cobalamin cobalamin
Gene NDC80 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.015 10. 7.001
Length SE - 1. 1. 0.
Lev Distance - 69. 71. 75.
UBS 13. 12. 13. 13.
BS 0. 0. 0. 0.
ILL 5. 3. 3. 4.
ILR 5. 6. 6. 4.
H 3. 3. 3. 3.
BL 5. 3. 3. 3.
BR 2. 2. 3. 3.
UN 0.108 0.232 0.092 0.133

Sequences

Field Description
UTR seq + 25 gugcguaaugacgucagcgccggcggagaauuucaaauucgaacggcuuuggcgggccgaggaaggaccugguguuuugaugaccgcuguccugucuagcagauacuugcacgguuuacagaaauucggucccugggucgugucaggaaacuggaaaaaaggucauaagcATGAAGCGCAGTTCAGTTTCCAGCG
UTR dot + 25 ………..((((((.((((.((((……….))))..)))).))))))((((.(((…((((.((..(((((..(((((.(((..(((((…)))))…))))))))..)))))..))))))))).))))……((((((((((…….((((….))))…….))))))))))….
RS 1 seq GAAUAGAUAAACUGCAAGGGUAUCCGGCUGCCAUAGGGCAAACCGGAUUUAAAAGGGAACCGGGUGAAAAUCCCGGACGGUCCGGCCACUGUAAGCGGGGAAUUGCUUUUAUAAAAGCCACUGGAAAAAUCCGGGAAGGUAAAAAGCAGUAAGGAGCCGCAAGUCAGGAGACCUGCCUUUACAGCAAAUUCAUA
RS 1 dot ………………(((((((((.((((….))))..))))))……….)))………(((((((…((((((…(((((((((….)))))..))))…)))…)))….)))))))………((.((((((….(((.(((….))).))))))))).))………
RS 2 seq AUUUCAUUAUUGCCCGUUGGUGAAGGGGAUGAGAGUCCAUUCUCUUCUUAAAAGGGAAGCUGGUGGAAAUCCAGCGCGGUCCCGCCACUGUAAAGCUGAGAUUUCUUAUAUAGGACCACUGUUUCUUUUCGAAGCGGGAAGGGAUAAGAAAUCGGCGAAGCUGAGCCAGGAGACCUGCCAAUCGGGAAGAACACAU
RS 2 dot …………(((.((((.((((((((((……))))))))))))))..)))….((((((((((((((((((((……)))))…)))).)))))))……..)))).(((((((((((((….((.(((..(……(((((…)))))……)..))).))..)))))))))).))).
RS 3 seq GCAUAGAAACGUUGUACAGGUGCAGAGAUGCUUAAUAGGGAACCGGGUGAAAAUCCCGGAACUGUCCCAGCAACCGUGAUGCGGACGAAAUGACGUAUACCACUGCUUUGGGUGUCAGGAUUGACAGGGAAAGCGGGAAGGUGUCGGAGUAGGAUGAAGCUAAGUCGGGAGACCUGCCUGUAUAUGACUCCUGGG
RS 3 dot ………((((((((((((…….((((…..((((.(((((…….)))))…..))))))))))).)).)))).)))..((..((.(((((.(((((((…(((((….)))))…)))))))…)))))))..))…………..(((((((…………….))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table