Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA070756-1 Similarity: 0.967 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA070756-1
Gene: NDOR1
MFE: -47.526
ENS: 0.852
Length: 136.
Predicted Ligands:
TPP - 15/20
cobalamin - 1/20
molybdenum - 1/20
 RS: URS0000C2AF33_1480154
MFE: -56.127
Ligand: TPP
Species: Marchantia polymorpha subsp. ruderalis TPP riboswitch (THI element)
 RS: URS0002320C20_1835702
MFE: -49.483
Ligand: TPP
Species: Penicillium arizonense TPP riboswitch (THI element)
 RS: URS0000ABC2E4_3694
MFE: -47.221
Ligand: TPP
Species: Populus trichocarpa TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA070756-1 URS0000C2AF33_1480154 URS0002320C20_1835702 URS0000ABC2E4_3694
Length 136. 135. 137. 135.
Similarity - 0.967 0.966 0.966
Ensemble Norm 0.852 - - -
MFE -47.526 -56.127 -49.483 -47.221
Ligands - TPP TPP TPP
Gene NDOR1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 11. 6.
Length SE - 1. 1. 1.
Lev Distance - 41. 39. 42.
UBS 10. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 2. 3. 2. 3.
H 3. 3. 3. 3.
BL 2. 3. 5. 2.
BR 4. 5. 3. 4.
UN 0.044 0.015 0.036 0.044

Sequences

Field Description
UTR seq + 25 gucacuuccggucgacggcggaaggcggaaggcggagcggucccugcaacccggccggcgggaacugccuucuaguuuuuagucucagaccagaccaccgggcgcaccccgATGCCGAGCCCGCAGCTTCTGGTGC
UTR dot + 25 ((((((…))).)))(((.(((((((((((((((…..((((.((……….)))))).))))))))).)))))).)))….((((((….((((((((……)))…)))))…..))))))..
RS 1 seq CCUCGGCACCAGGGGUGCUUGUUCUGUGGUGGCCCUAGCUUUCUUUGCUAGAGCUUCUCACAAGAACAGGCUGAGAGAGUCCCUUCGCACCUGAACAGGAUAAUUCCUGCGUAGGGAGCGUGCCAGACUUCUUUU
RS 1 dot ((((…….)))).(((((((((((((.(((.(((((…….))))).))).).)))).)))))))).(((((((((….(((.((((..(((((….)))))..))))..)))…..)))).)))))
RS 2 seq CGCAUGACAGGUGUUCGGCUCAACUGGUCGGGGGACCCUAAGCUUAGGACUUCCCUCGACUAGUUGGCCGUUCUGAGAUUAUACUGUCAAAACUUGAUCUAGACAAUACUAGCGAAAGGACAUGCGUGACUUUGAUU
RS 2 dot .((((…..)))).((((.(((((((((((((((.((((….))))…))))))))))))))))))).((.(((.((((.(((((….(((…((((……))))…))))))).).))))))).))..
RS 3 seq AGAAAGCACCAGGGGUGCCUGCGUCCUGCUUCAAAACUGGCCAUCUGGCUAGAGGAGGCAGCUGGCCAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGAUAAUGCCUGCGUAGGGAGUGUGCAUUUUUUCUGUC
RS 3 dot …..(((((…)))))(((.((((((((((….((((((….))))))..)))))))..))))))((.(((((((((((((….((((..((((……))))..))))))).).).)))))))).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table