Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071169 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA071169
Gene: NDUFA2
MFE: -26.732
ENS: 0.991
Length: 97.
Predicted Ligands:
TPP - 8/20
glycine - 7/20
SAM - 2/20
 RS: URS0000DAC5C8_1797747
MFE: -29.307
Ligand: homocysteine
Species: Curvibacter sp. GWA2_64_110 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB764C_910954
MFE: -36.601
Ligand: glycine
Species: Dietzia cinnamea P4 Glycine riboswitch
 RS: URS0000AB2B8D_408172
MFE: -28.706
Ligand: TPP
Species: marine metagenome TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071169 URS0000DAC5C8_1797747 URS0000AB764C_910954 URS0000AB2B8D_408172
Length 97. 97. 97. 99.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.991 - - -
MFE -26.732 -29.307 -36.601 -28.706
Ligands - homocysteine glycine TPP
Gene NDUFA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 6.009 4.001
Length SE - 0. 0. 4.
Lev Distance - 28. 30. 27.
UBS 8. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 0. 1. 1. 0.
H 2. 2. 3. 3.
BL 2. 2. 2. 2.
BR 4. 2. 2. 3.
UN 0.113 0.052 0.206 0.141

Sequences

Field Description
UTR seq + 25 aggguccgcgguuggucagaccggggcacuuggccugaagaccuggaauuggcgacuucgauauuaacaaggATGGCGGCGGCCGCAGCAAGTCGAG
UTR dot + 25 ….((((.((((..((((.(((((…))))).)))).))))))))…..((((((((………….((((….))))).).))))))..
RS 1 seq CAUUCCGAGGAGCGUUGCAGUUCACAUCCCGUUGAACGAGGCUCGGACCCGUGGAAGGGCACCGCCCCCUCCACCGCAUCAACGGCGCUCACCCACG
RS 1 dot …(((…((((.((…(((((……..))))))).)))))))..(((((..((((.(((………………))).))))..)))))
RS 2 seq ACGCGUCCCACGGGAGAGCUCCGCGGCCAUGGCCGCGGGCGCCGAAGGAGCAACUCCUCUCCGAGAAUCUCUCAGGCACCCGGACCGUGCGGUCGUC
RS 2 dot ..((.(((..(((….((.(((((((….))))))))).)))..)))))………((((((…)))).))……((((….))))…
RS 3 seq UAUAAGUCCAAGGGGUGCCAAUUGGCUGAGAUGGUUUUAACCAAUCCCUUUGAACCUGAUCCGGUUAAUACCGGCGUAGGAAUGGAUUUUCUCUACAGC
RS 3 dot …..((.(((((((…..(((((.(((((…))))).)))))))))))).))…..(((((….))))).(((((((……))).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table