Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071175 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA071175
Gene: NDUFA5
MFE: -19.
ENS: 0.859
Length: 99.
Predicted Ligands:
TPP - 15/20
purine - 4/20
glycine - 1/20
 RS: URS0000BE2120_1262893
MFE: -25.401
Ligand: TPP
Species: Eubacterium sp. CAG:786 TPP riboswitch (THI element)
 RS: URS0000ABC291_518637
MFE: -20.371
Ligand: TPP
Species: Eubacterium biforme DSM 3989 TPP riboswitch (THI element)
 RS: URS0000C2D6C8_403957
MFE: -21.521
Ligand: TPP
Species: Virgibacillus sp. SK37 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071175 URS0000BE2120_1262893 URS0000ABC291_518637 URS0000C2D6C8_403957
Length 99. 99. 100. 99.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.859 - - -
MFE -19. -25.401 -20.371 -21.521
Ligands - TPP TPP TPP
Gene NDUFA5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.015 7.003 8.020
Length SE - 0. 1. 0.
Lev Distance - 29. 28. 29.
UBS 8. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 1. 0. 2. 2.
H 4. 3. 4. 3.
BL 3. 2. 1. 1.
BR 1. 1. 1. 1.
UN 0.202 0.323 0.150 0.061

Sequences

Field Description
UTR seq + 25 aauucagcugcagggaguguugcuacugauggaacaaaaccaaaccacuuggaauuaacgcacaauuuaaagagATGGCGGGTGTGCTGAAGAAGACCA
UTR dot + 25 …((((..((((……))))..))))……….((((…..))))……(((.(.((((….))))))))(((.(……..).))).
RS 1 seq UUUAUUUGCUGGGGGUACUCGCGAGAGUUGAGAGGGCUUCUGCCCGACCCUUUGAACCUGUUGGUUAAUACCAUCGUAGGGAAGCCGUGACAUAAUAUC
RS 1 dot ….(((((.(((….))))))))……..((((….))))..((((.(((……((((….))))))).))))………………
RS 2 seq CUGUUAAAAGUGGGGAGCUUUUAGGCUGAGAGUAGGUUUGUCCUAGACCCAAUAACCUGAUUUGGAUAAUGCCAACGUAGGGAAUAUAUCUUUUUGAUAG
RS 2 dot …((((((((…..))))))))..((.(..((((…..))))..).))….((((..((((……))))..))))…..((((…..)))).
RS 3 seq GUCAAUCACUAGGGGAGCACAUUGGUGCUGAGAGAAUAAAUUCGACCCUUUGAACCUGAACUGGUUAAUACUAGCGUAGGGAAGUGCAGGAGAAAGUUC
RS 3 dot …..(((..((((((((((….)))))…………….)))))))).((((..(((((….)))))..))))(((.(………).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table