Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071183 Similarity: 0.987 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA071183
Gene: NDUFA7
MFE: -18.182
ENS: 0.915
Length: 63.
Predicted Ligands:
fluoride - 15/20
unknown - 5/20

 RS: URS0000D9B176_1895778
MFE: -22.808
Ligand: fluoride
Species: Magnetospirillum sp. 64-120 Fluoride riboswitch
 RS: URS0000E5FB23_1121291
MFE: -16.036
Ligand: unknown
Species: Clostridium acidisoli DSM 12555 DUF1646 RNA
 RS: URS0000D8628C_582899
MFE: -19.170
Ligand: fluoride
Species: Hyphomicrobium denitrificans ATCC 51888 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071183 URS0000D9B176_1895778 URS0000E5FB23_1121291 URS0000D8628C_582899
Length 63. 63. 62. 62.
Similarity - 0.987 0.987 0.987
Ensemble Norm 0.915 - - -
MFE -18.182 -22.808 -16.036 -19.170
Ligands - fluoride unknown fluoride
Gene NDUFA7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 3.001 3.001
Length SE - 0. 1. 1.
Lev Distance - 15. 16. 16.
UBS 6. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 1.
ILR 2. 2. 2. 1.
H 2. 2. 2. 2.
BL 2. 0. 2. 2.
BR 0. 2. 1. 1.
UN 0.032 0.032 0.065 0.065

Sequences

Field Description
UTR seq + 25 acgucaccggcugcgcccuucaguaucgcggacggaagATGGCGTCCGCCACCCGTCTCATCC
UTR dot + 25 ..(((..(((.(((……..))))))..)))(((((((((.((…..))))))))..)))
RS 1 seq GCGUGGGAUGGGGAUGGAGCUCCCCGACAACCGCCCGCGAGGGCUGAUAGCUCCUGCUGCGAG
RS 1 dot ..((((..((((((……))))))….))))(((((((((((…))).)))..)))).)
RS 2 seq GGUUGAGCAAGCAGAAUAUGCUUGUAUUCAAGAGAUUUAUAUGUCUUCUGGGGUGGGGAGUC
RS 2 dot ..(((((((((((…..)))))))..))))..(((((.(((.((….)).)))..)))))
RS 3 seq GCCGUCGAUGGGGAUGGGGUUCCCCGAUAACCGCCGCUAUGGCUGAUGACUCCUGGCGAGGC
RS 3 dot ((.((…((((((……))))))…)).))(((((.((………)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table