Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071188 Similarity: 0.993 Similarity: 0.992 Similarity: 0.989
UTR: 5HSAA071188
Gene: NDUFA8
MFE: -8.986
ENS: 0.988
Length: 47.
Predicted Ligands:
SAM - 12/20
unknown - 6/20
preQ_1 - 2/20
 RS: URS00021EE0A1_12908
MFE: -5.219
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000D6AF81_12908
MFE: -8.707
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
 RS: URS0000D6A7AB_12908
MFE: -9.362
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071188 URS00021EE0A1_12908 URS0000D6AF81_12908 URS0000D6A7AB_12908
Length 47. 46. 47. 47.
Similarity - 0.993 0.992 0.989
Ensemble Norm 0.988 - - -
MFE -8.986 -5.219 -8.707 -9.362
Ligands - SAM unknown unknown
Gene NDUFA8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 2.022 1.037
Length SE - 1. 0. 0.
Lev Distance - 8. 10. 14.
UBS 3. 2. 2. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 1. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.298 0.239 0.149 0.106

Sequences

Field Description
UTR seq + 25 cuaacaacaccgcagauaaagcATGCCGGGGATAGTGGAGCTGCCCA
UTR dot + 25 ………..(((………)))..(((.((((…))))))).
RS 1 seq AGAUUACAACGGCUACCUGACGUUAUCUUUAUUUGAAAAUGGAGCG
RS 1 dot …….((((………))))..(((((((….)))))))..
RS 2 seq GGUUGGGCGUAUUGCUUUCAAGAUGUGGCCUUUUUGGGUGAGGGGGC
RS 2 dot …….((((((……..))))))((((((((….))))))))
RS 3 seq GGUUGGGCGUAUUGCUUUCAAGAUGUUGCCUUUUUGGGUGAGGGGGC
RS 3 dot …..(((((.(((….))).)))))((((((((….))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table