Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071201 Similarity: 0.980 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA071201
Gene: NDUFA9
MFE: -21.314
ENS: 0.931
Length: 89.
Predicted Ligands:
TPP - 15/20
glycine - 3/20
fluoride - 1/20
 RS: URS0000DB5ADD_1986854
MFE: -21.640
Ligand: TPP
Species: Rhizobiales bacterium TMED25 TPP riboswitch (THI element)
 RS: URS0000C21318_1423790
MFE: -21.459
Ligand: TPP
Species: Lactobacillus pasteurii DSM 23907 = CRBIP 24.76 TPP riboswitch (THI element)
 RS: URS0000AB8663_50743
MFE: -17.665
Ligand: TPP
Species: unidentified eubacterium SCB49 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071201 URS0000DB5ADD_1986854 URS0000C21318_1423790 URS0000AB8663_50743
Length 89. 90. 90. 91.
Similarity - 0.980 0.978 0.977
Ensemble Norm 0.931 - - -
MFE -21.314 -21.640 -21.459 -17.665
Ligands - TPP TPP TPP
Gene NDUFA9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.004 3.006 3.
Length SE - 1. 1. 4.
Lev Distance - 25. 28. 25.
UBS 4. 4. 5. 5.
BS 0. 1. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 2. 2. 2.
H 3. 2. 3. 3.
BL 0. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.124 0.189 0. 0.143

Sequences

Field Description
UTR seq + 25 agcauugguacaugaacuuugaggguucauucuaguaccaagaaccucagucaaugaaaaagaaATGGCGGCTGCCGCACAATCCCGGG
UTR dot + 25 ….(((((((((((((((…))))))))….)))))))……(((((……………..)))))(((……..))).
RS 1 seq AAAUCAUGACAGGGGUGCCUUAUGGGCUGAGAUAAACCCUUUUAACCUGAUCCAGAUAAUGCUGGCGGAGGAAGUCAUGAUGAAUUUCUU
RS 1 dot ..((((((((((((((((((…))))……..))))))….(((…((((……))))…)))..))))))))………
RS 2 seq AACAUAUUGAAGGGGUGCCCUAAUGGGCUGAGAUUAGACCCUAGAACCUGUUGAGAUAAUGCUCGCGUAGGAAUCAAUUAUAAUUUUGAA
RS 2 dot ………..(((((((((….))))………)))))….((((.((((……))))..))))..((((……..)))).
RS 3 seq UAGAAACUUUAGGGGUGCUGUAAUGGCUGAGAAUUACCCUUAGAACCUGAAACCGAUAAUGCGGGCGAUAGGGAAAAGUGUUACAUAGCUC
RS 3 dot …….((((((((((((…..)))……..))))))))).((((…(((……)))….))))….(((……..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table