Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071238 Similarity: 0.974 Similarity: 0.973 Similarity: 0.970
UTR: 5HSAA071238
Gene: NDUFAF4
MFE: -40.932
ENS: 0.846
Length: 115.
Predicted Ligands:
TPP - 8/20
SAM - 8/20
FMN - 4/20
 RS: URS0000C79A0B_411475
MFE: -35.526
Ligand: TPP
Species: Flavonifractor plautii ATCC 29863 TPP riboswitch (THI element)
 RS: URS0000DA2BB1_1797839
MFE: -27.757
Ligand: TPP
Species: Deltaproteobacteria bacterium RBG_16_48_10 TPP riboswitch (THI element)
 RS: URS0000DA8CD9_1121420
MFE: -29.822
Ligand: FMN
Species: Desulfosporosinus lacus DSM 15449 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071238 URS0000C79A0B_411475 URS0000DA2BB1_1797839 URS0000DA8CD9_1121420
Length 115. 113. 115. 116.
Similarity - 0.974 0.973 0.970
Ensemble Norm 0.846 - - -
MFE -40.932 -35.526 -27.757 -29.822
Ligands - TPP TPP FMN
Gene NDUFAF4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.007 4. 4.006
Length SE - 4. 0. 1.
Lev Distance - 29. 35. 38.
UBS 7. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 0.
ILR 3. 2. 4. 2.
H 3. 2. 2. 3.
BL 1. 2. 0. 2.
BR 1. 2. 1. 2.
UN 0.104 0.186 0.113 0.181

Sequences

Field Description
UTR seq + 25 acuugugcgcaugcuccgggugucccggaguuguccugcgccgguguucccacgugcggccugaaccugagcgcauaauguuaugaggagATGGGAGCACTAGTGATTCGCGGTA
UTR dot + 25 ……(((((.((((((((…))))))))…..))))).((((((((((((((((..(…….)..)))))………….).)))))))))).(((…)))….
RS 1 seq AACUGAAUGCUGGGGGGCCGGAUGGAAUCCGGCUGAGAGUUAGGCUGUUCUGCCUAUGACCCAUGGAACCUGUUGGGUAAUGCCAUCGUAGGGAGCGCGGUUCACGCCGUUUU
RS 1 dot ……..(((….((((((((…))))))))…)))..((((((.((.(((((((((((……….))))……..))))))).)).))))))………..
RS 2 seq CAAGAUGUCGCGGGGAGUUGGGAUGAGCCUAGCUGAGAGGGUGACCGAAACAGUCAUCGACCCGCUGAACCUGACCUGGAUAAUACCAGCGGAGGAAUCGACAGACAAGUGACUA
RS 2 dot ……(((((….(((((((…..)))))))……)))))……((((((((((((((((..((……))…….)))))).)…))))……..))))).
RS 3 seq AUACUCCUCUGGGGUUGGGUGAGAUUCCCUACCGGCGGUAAAGCCCGCGAGCCUUUUUUGGCAGAUCUGGUGAAAUUCCAGGGCCGACAGUACAGUCUGGAUGAGAAGAGGAACAG
RS 3 dot …………(((.(((…….))).))).((((……))))…((((((((.((((((((((…….))))………….)))))..).))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table