Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071239 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA071239
Gene: NDUFAF4_0
MFE: -40.932
ENS: 0.816
Length: 118.
Predicted Ligands:
SAM - 12/20
FMN - 6/20
glycine - 1/20
 RS: URS0000C0C91E_61635
MFE: -23.124
Ligand: FMN
Species: Acholeplasma brassicae FMN riboswitch (RFN element)
 RS: URS0000C7E76E_1345695
MFE: -29.058
Ligand: FMN
Species: Clostridium saccharobutylicum DSM 13864 FMN riboswitch (RFN element)
 RS: URS0000C7B73B_1750719
MFE: -30.825
Ligand: SAM
Species: Kurthia sp. 11kri321 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071239 URS0000C0C91E_61635 URS0000C7E76E_1345695 URS0000C7B73B_1750719
Length 118. 117. 118. 118.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.816 - - -
MFE -40.932 -23.124 -29.058 -30.825
Ligands - FMN FMN SAM
Gene NDUFAF4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.005 1.001 3.035
Length SE - 1. 0. 0.
Lev Distance - 35. 37. 37.
UBS 7. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 0.
ILR 3. 3. 3. 2.
H 3. 3. 3. 3.
BL 1. 1. 1. 1.
BR 1. 1. 1. 2.
UN 0.127 0.197 0.161 0.314

Sequences

Field Description
UTR seq + 25 cucacuugugcgcaugcuccgggugucccggaguuguccugcgccgguguucccacgugcggccugaaccugagcgcauaauguuaugaggagATGGGAGCACTAGTGATTCGCGGTA
UTR dot + 25 ………(((((.((((((((…))))))))…..))))).((((((((((((((((..(…….)..)))))………….).)))))))))).(((…)))….
RS 1 seq UUAAUACUUCGGGGCAAGGUGUGAUUCCUUGAUCGGCGGUUAUAGUCCGCGAACCUACGGGUUGAGCUAGUGUAAUUCUAGUACCGACAGUUAUAGUCUGGAUGGGAGAAGAAAUGU
RS 1 dot ………(((..(((((…….))))).)))((((…….))))…(((((((((((.(((((…….)))))..))))………)))..))))………..
RS 2 seq AUAUAUCUUCAGGGCAGGGUUAAAAUCCCUACCGGCGGUAUAGCCCGCGAGCUUUAAUUUAAGCAGAUUCGGUGUAAUUCCGAAGCCGACAGUAUAGUCUGGAUGAAAGAAGGUAACC
RS 2 dot …………((.((((…….)))).)).((((……))))..(((((..((((..((((((((((………..)))))…….)))))..))))..)))))….
RS 3 seq CUCUUAUCCCGAGCUGGUGGAGGGUCAGGCCCUAUGAAACCCGGCAACCUGCAUUUCAUUUCACGAGAUGCGCUGGUGCUAAUCUGAAUGCAAGGAUUCAUUCCUUGAACGAUAAGAG
RS 3 dot …………((((((.((((((…))))).).)…))))).(((((((((((…….))))))))..)))………….((((((…..))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table