Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071260 Similarity: 0.962 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA071260
Gene: NDUFB6
MFE: -56.526
ENS: 0.995
Length: 149.
Predicted Ligands:
glucosamine - 11/20
cobalamin - 7/20
zmp-ztp - 1/20
 RS: URS0000BE9F71_84024
MFE: -34.951
Ligand: glucosamine
Species: Clostridium disporicum glmS glucosamine-6-phosphate activated ribozyme
 RS: URS000233435E_1658665
MFE: -85.334
Ligand: zmp-ztp
Species: Mitsuaria sp. 7 ZMP/ZTP riboswitch
 RS: URS0002312B1E_1117647
MFE: -54.725
Ligand: cobalamin
Species: Simiduia agarivorans SA1 = DSM 21679 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071260 URS0000BE9F71_84024 URS000233435E_1658665 URS0002312B1E_1117647
Length 149. 149. 148. 149.
Similarity - 0.962 0.962 0.961
Ensemble Norm 0.995 - - -
MFE -56.526 -34.951 -85.334 -54.725
Ligands - glucosamine zmp-ztp cobalamin
Gene NDUFB6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.012 6.022 15.024
Length SE - 0. 1. 0.
Lev Distance - 47. 47. 46.
UBS 9. 10. 10. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 1. 2. 3. 3.
H 3. 4. 3. 4.
BL 3. 2. 3. 3.
BR 3. 1. 4. 4.
UN 0.242 0.134 0.095 0.087

Sequences

Field Description
UTR seq + 25 guaauaaccgcgcgcggcgcucggcguucccgcaaggucgcuuugcagagcgggagcgcgcuuaaguaacuaguccguaguucgagggugcgccguguccuuuugcguugguaccagcggcgacATGACGGGGTACACTCCGGATGAGA
UTR dot + 25 ………((((…))))…((((((((((….((……..))))))))))))………………..(((((.(((((.(((.((((…((((((((….))))).)))…)))).))).))))))))))….
RS 1 seq AACUAAAUCAAAGAUUUAGGAUCUCACUUAAGUUGACGAGGAUGGGGAGUAUCGAAUUCUUCGGCGGGUGCCCCACGGUAUCGCACUACCGUUAACAGUUAGUAAAUCUAUGAAGUGAUUUGUAGGACAACACUAACUUGGUGUUAAAA
RS 1 dot ..(((((((…)))))))((((((.((((..((….))..))))))).)))……….((.((((((….))))))))..(((((…..(((((((…((((((((….))))))))…..))))))))))))……
RS 2 seq CGGGCUUCGCGCAACUGGCGAUCAGGGCGCCCUGACCGGAGACGGAUCUGUCUCCGGCGCAGGCGUCGCCCGAGGUGGGCCACCACCGGGAAGCGCGAACGGCCGGGGAUCUCCCUGGCUGUCCGUGCCGUUCGCCUGGGCCGCCGUC
RS 2 dot ……((((…….))))…((((((((((.(((((((((….)))))))))..)))).).)))))..(((((.(((….((((..(((((.((((((((((….)))))))))).)))))..))))..))).)))))…
RS 3 seq AUCGCACGCAGGUGCCAGGGUGACCACCUAAGGAUGAGUGGUCAUGCUCUGGUUAAAUGGGAAACCGGUGAAACUCCGGUGCUGCCCCCGCAACGGUAAGGCCGAACUGAACGGCCAAGCCCGAUACCGGCCUGAGGCGCGCUUGAAGC
RS 3 dot …((((….)))).((.(((((((((…….).)))))))).))((((((……..))))))……((.(((((.(((((((….(((..(((((…….)))))..)))……)))…).)))))))).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table