Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071267 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA071267
Gene: NDUFB7
MFE: -50.596
ENS: 0.904
Length: 99.
Predicted Ligands:
glycine - 10/20
zmp-ztp - 3/20
TPP - 3/20
 RS: URS0000D86931_1933778
MFE: -39.194
Ligand: glycine
Species: Saccharothrix sp. ALI-22-I Glycine riboswitch
 RS: URS0000C746AC_456900
MFE: -33.644
Ligand: glycine
Species: Cyphomyrmex costatus Glycine riboswitch
 RS: URS0000C64262_1794906
MFE: -33.091
Ligand: glycine
Species: Marinobacter sp. T13-3 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071267 URS0000D86931_1933778 URS0000C746AC_456900 URS0000C64262_1794906
Length 99. 100. 97. 99.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.904 - - -
MFE -50.596 -39.194 -33.644 -33.091
Ligands - glycine glycine glycine
Gene NDUFB7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 6. 4.004
Length SE - 1. 4. 0.
Lev Distance - 21. 21. 27.
UBS 7. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 1. 0. 1. 1.
H 3. 3. 3. 3.
BL 3. 2. 3. 3.
BR 0. 3. 2. 2.
UN 0.061 0.080 0.072 0.121

Sequences

Field Description
UTR seq + 25 acugaggggucagugguuccggguaggagcuaggugacccucggcugcugcagggaucugcagcgacugcagccATGGGGGCCCACCTGGTCCGGCGCT
UTR dot + 25 .((((.((((((.(((((((…..)))))))..)))))))))).((((((((….))))))))…((.(((….(((((…..)))))))))).
RS 1 seq GCAACUCUGGAAAGCAGGCGUGUUCGCGGCGCCUCGCCCACGGUGCAAGCCGCCCUCAUCCGGCGGCGAAGCUCUCAGGCUCAUGAACAGAGGGGGAGGC
RS 1 dot ((.(((.(((…((((((((…….)))))).))))).)))))..((((((…….))))))….(((((…(((…….))).)))))..
RS 2 seq GCAACUCUGGAAAGUUAGGACUUCGCGUCCUGCGCCCACGGUGCAAGCUGCCUAAACAGCGGCGAAGCUCUCAGGCUCCGAUGACAGAGCGGGGAGG
RS 2 dot ((.(((.(((…(.((((((…..)))))))..))).)))))..(((((…….)))))….(((((..((((……..)))).))))).
RS 3 seq AUAACGCCGUCUGGAGAGAGGCUGCAAAGGCAGUCCACCGAAGGGGCAAACAGGGCAGAGCCCUGUAAACUCUCAGGUAUCAGGGACAGGGGGAGAGGC
RS 3 dot …..(((.(.(((…(.((((((….))))))).)))..).)))..(((((((…)))))))…(((((………………)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table