Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071271 Similarity: 0.983 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA071271
Gene: NDUFB8
MFE: -37.495
ENS: 0.984
Length: 87.
Predicted Ligands:
guanidine - 9/20
SAM - 4/20
TPP - 4/20
RS: URS00021EE001_12908
MFE: -27.338
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
RS: URS0000C2B282_319652
MFE: -9.692
Ligand: SAM
Species: Pediococcus cellicola SMK box translational riboswitch (SAM-III)
RS: URS00021EE0BC_12908
MFE: -27.193
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071271 URS00021EE001_12908 URS0000C2B282_319652 URS00021EE0BC_12908
Length 87. 88. 87. 88.
Similarity - 0.983 0.980 0.979
Ensemble Norm 0.984 - - -
MFE -37.495 -27.338 -9.692 -27.193
Ligands - guanidine SAM guanidine
Gene NDUFB8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.030 4.002 5.030
Length SE - 1. 0. 1.
Lev Distance - 21. 26. 26.
UBS 3. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 0. 2. 0.
H 1. 2. 1. 2.
BL 0. 0. 1. 1.
BR 0. 0. 0. 1.
UN 0.241 0.068 0.287 0.068

Sequences

Field Description
UTR seq + 25 gcagaagggaaacgugaagaaggaccccagaagaacgggccgccgccgccaagaaguauaauATGGCGGTGGCCAGGGCCGGGGTCT
UTR dot + 25 …………………(((((((………((((((((((((((…………))))))))))…)))))))))))
RS 1 seq AUAUGGUUGCCACCGGGUAAGAAAUGCAAUAGCAUUCAUGUAUGCAUCGUUAGGUCUUAGAAGAUGUAUAUGUGGAUGCAUUUUUUAU
RS 1 dot ….(((….)))..((((((((((((……((((((((((((((…………..))))))))))))))))))))))))))
RS 2 seq AAACGUAAUUUUUGUUCCCGAAAGGAUUUGCUUAAUUGCAAAGAUGCCUUGUAACCGUAUUUAAUUAAGGGGGAAAUUUUCAAGAUG
RS 2 dot ……………….(((((..(((.((((((((….(((((………)))))))))))))..)))..)))))……
RS 3 seq AUUGCUCUGCCACCGGGUAGAAAGAGUAAAAGUAUUCAUUUAUACAUCGUUAGGUCUUAGAAGAUGUGUAAAAGGAUGCUUAUUUUUA
RS 3 dot …..((((((….))))))(((((((..(((((((.((((((((((…………..)))))))))).)))))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table