Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071289 Similarity: 0.961 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA071289
Gene: NDUFS1
MFE: -60.199
ENS: 0.820
Length: 152.
Predicted Ligands:
cobalamin - 10/20
FMN - 7/20
glucosamine - 2/20
 RS: URS000231267C_560556
MFE: -58.239
Ligand: cobalamin
Species: Asanoa sp. 210121 Cobalamin riboswitch
 RS: URS0002317CCC_1805632
MFE: -31.247
Ligand: cobalamin
Species: Acinetobacter sp. SFC Cobalamin riboswitch
 RS: URS0002330821_1805632
MFE: -30.620
Ligand: cobalamin
Species: Acinetobacter sp. SFC Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071289 URS000231267C_560556 URS0002317CCC_1805632 URS0002330821_1805632
Length 152. 151. 152. 152.
Similarity - 0.961 0.959 0.957
Ensemble Norm 0.820 - - -
MFE -60.199 -58.239 -31.247 -30.620
Ligands - cobalamin cobalamin cobalamin
Gene NDUFS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 4. 6.003
Length SE - 1. 0. 0.
Lev Distance - 49. 53. 55.
UBS 11. 10. 10. 11.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 1. 3. 2.
H 5. 5. 5. 6.
BL 2. 1. 3. 2.
BR 3. 3. 2. 1.
UN 0.230 0.179 0.230 0.178

Sequences

Field Description
UTR seq + 25 uucuccaggcccggcugacagaguuagccgaggccgccauauugaauaagcgacccggccuccuagggggucgucgugguccagacaguuuagcagaacagccuccgcggcuccggggagaagcaauATGAGGATCAGGGGGTCCTCGGGAA
UTR dot + 25 …….((((((((((((…)))))))).))))…………..(.((((((((..(((…)))..)))).)))))…..((((….)))).((((((.((….)).))))..))….((((((((….))))))))….
RS 1 seq AACAGCCCUGCCGACCAUGGUGACCUGUGCGUUACCGUGCUCCGGACCCCACGCAGCGAAGCCGGUGUGAACCCGGCGCUGUCCCGCAACUGUGAUGCCCCCGGUUUUCCGGGGGACAAGCCAGGUCGCCUGCCAAGGUCGCGAACCAGCG
RS 1 dot ……….((((.(((((((((……))))))))).)).))…….(((((…(((((…….))))))))))…….(((…(((((((((….))))))).))…)))…((((….))))(((……)))
RS 2 seq UACUCUGCGUGCGCUUCAGGUGCUUCCAUAGAGAAGUGAAACUGGGAAGUUAGUUAAAUUUUUGAAUUUAAAGCUAACACUGCCCCCGCAACGGUGAAUAGUUAUCUUGUUAUAACUUAAGUCCGGAGACCGGCCUGCUGCAAACCUAAUUU
RS 2 dot ..(((((.(.(((((…)))))…).)))))……….(((..((((((((((((….))))))..))))))….)))(((…)))…..((((((……))))))..((.((((…)))).))…………….
RS 3 seq CUGCUGCGCGUACCUACAGGUACUUCCAUUACGAGAAGUGAAAUUGGGAAGUCAUUCCAACCUACAAUGGUUUGAAGCUAACACCGCCCCCGCAACGGUGAAUAGUUAUUUAUAACUUAAGUCCAGAGACCGGCCUGAAGCAAGUCCAACAU
RS 3 dot ………(((((….)))))(((((((((…..))))…)))))(((..(((.((((……)))).))))))..(((((………)))))…(((((….)))))……..(.(((..((…..))..))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table