Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071293 Similarity: 0.968 Similarity: 0.967 Similarity: 0.964
UTR: 5HSAA071293
Gene: NDUFS1_0
MFE: -42.039
ENS: 0.954
Length: 129.
Predicted Ligands:
SAM - 5/20
glycine - 4/20
FMN - 3/20
 RS: URS0000C84AD8_1690485
MFE: -39.095
Ligand: homocysteine
Species: Betaproteobacteria bacterium UKL13-2 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C786E6_1619031
MFE: -32.296
Ligand: SAM
Species: Candidatus Yanofskybacteria bacterium GW2011_GWD2_39_48 SAM riboswitch (S box leader)
 RS: URS0000A25484_1867952
MFE: -42.
Ligand: glycine
Species: Candidatus Terasakiella magnetica Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071293 URS0000C84AD8_1690485 URS0000C786E6_1619031 URS0000A25484_1867952
Length 129. 129. 129. 127.
Similarity - 0.968 0.967 0.964
Ensemble Norm 0.954 - - -
MFE -42.039 -39.095 -32.296 -42.
Ligands - homocysteine SAM glycine
Gene NDUFS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3.002 3.
Length SE - 0. 0. 4.
Lev Distance - 42. 44. 42.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 2. 2. 2.
H 3. 3. 3. 3.
BL 4. 5. 3. 3.
BR 3. 2. 2. 2.
UN 0.155 0.132 0.202 0.142

Sequences

Field Description
UTR seq + 25 ugagagccggcagauggggggcuuuuagccacggucucuggucugaugaagcagaaaagaagaugaggaucaggggguccucgggaacgcugucacgaaucaauATGAGGATCAGGGGGTCCTCGGGAA
UTR dot + 25 (.(((.((((.((((.(..((((…)))).).))))))))))).)….((((………((((((((….))))))))……))))…………((((((((….))))))))….
RS 1 seq AUUGCUGAGGAGCGUUGCGACUACCGCACUGGUUUUUUAGUGGCUGGUUCCAGGCUCAGCAAGGGUACGAAGGUGACGGGUGUUCCCGUUUUCCACAACUGCCCCAAGAAUCAACGACGCUCGCAUCCG
RS 1 dot .(((((…((((.(((.(((((.(.((((((….))))))).))))).))))))))))))(((((….((.((((((….))))))..))…..)))))……….(((…)))……
RS 2 seq AAGUUAUUAAGAGUAUGGCGAGAGCAACUGGCUCAAUGACCCAUCAGCAACCUGCCUUGUCCUUCGAAGCUUUAGCGAAGGAGGAUCAGUAAGGUGCUAAUUCCAGCCCGUAAAAGGGAGAGAUAAUAC
RS 2 dot ..((((((..((((…((….))…..))))))))))…..(((.((((((.((.(((((((………))))))).))…))).))))))……..(((……)))………..
RS 3 seq AGACUCUGGAAAGUGGAUUGCACGUUUAUAUGCCAUCCCACCGACGAGGAAACCCUACACGCAUAGGCUCGUGUAUUUGAGCCAAGCUGUGGGGGAAUCUUUCAGGUUCCAUGACAGAGAGGGGCCA
RS 3 dot …((((((…(.((((.(((……..))).))))).)))..)))….(((((((.((…((((((……))))))..)))))))))……….((((((……….)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table